Aedes koreicus

(Edwards, 1917) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records575

Data sources10

Biological traits0

DNA specimens362

eDNA detections350

Sources10 archives

Databases and archives Aedes koreicus's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility575 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI350 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics362 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF575 records

Environmental DNA1 datasets · 7 countries350 detections

DNA & barcodingBOLD362 specimens

Genome at a glanceGoaT · TreeOfSex · NCBI≈1.2 Gbp

01Narrative

Aedes koreicus is a mosquito species originally described from KoreaF. W. Edwards. Notes on Culicidae, with Descriptions of New Species. Bulletin of Entomological Research, 7: 201-229; 212-213; http://www.mosquitocatalog.org/files/pdfs/039100-17.pdf . that has been shown to be enzootic to Japan, northeastern China, the Republic of Korea (South Korea), parts of Russia,European Centre for Disease Prevention and Control (ECDC): Aedes koreicus, http://ecdc.europa.eu/en/healthtopics/vectors/mosquitoes/Pages/aedes-koreicus.aspx#sthash.3mOyNNJW.dpuf , accessed 15 Mar 2016. but recently found in Belgium, Italy,Thomas V. Gaffigan, Richard C. Wilkerson, James E. Pecor, Judith A. Stoffer and Thomas Anderson. 2016. "Aedes (Fin.) koreicus" in Systematic Catalog of Culicidae, Walter Reed Biosystematics Unit, http://wrbu.si.edu/SpeciesPages_non-ANO/non-ANO_A-hab/AEkor_hab.html , accessed 16 Mar 2016. Germany, Hungary, Slovenia, Switzerland Steinbrink, A., Zotzmann, S., Cunze, S. et al. Parasitol Res (2019) 118: 1073. https://doi.org/10.1007/s00436-019-06232-x and Kazakhstan. Adult Aedes koreicus are relatively large, with areas of white scales on black background, strongly resembling Aedes japonicus, which has also become established outside its native range.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding362 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes koreicus has left across the world's sequence archives.

At a glance

DNA specimens362

BINs2

Marker genes3

eDNA detections350

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P632 bp consensus345 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

59Tmostly conserved

62Amostly conserved

107Cmostly conserved

245Tvariable

258Cmostly conserved

290Gmostly conserved

317Cmostly conserved

587Cvariable

GATCCGGAATAGTAGGGACATCTTTAAGAATCTTAATTCGAACTGAATTAAGACACCCTGGAATATTTATTGGAAATGATCAAGTTTATA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.85%

Haplotypes35

BINs2

Most divergent pair6.8%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes canadensissame genus8.4%Aedes alboannulatussame genus8.5%Aedes pullatussame genus8.7%Aedes japonicussame genus8.9%Aedes cantatorsame genus9.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS216S

animal barcodefungal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_046946 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3NADH dehydrogenase subunit 3ND5ND4ND4LND6CYTBND1large subunit ribosomal RNAsmall subunit ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · TreeOfSex · NCBI

The complete instruction manual Aedes koreicus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 243 868 763 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aedes koreicus1.24 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 6 n = 3

Chromosome records6–62n range6median6mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 64×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Makino, S. (1951). An atlas of the chromosome numbers in Animals. Ames, Iowa, Iowa State College Press. ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type575 records

Wild obs. + sensor393

Museum / vouchered182

Origin

Introduced23

Range

Area of Occupancy AOO864 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 64≤1 km 10>10 km 2

76 georeferenced · 317 without coordinates

Open the mapobservation + sensor393

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 182 records without

Open the institutions mapphysical evidence182

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
ITGlocation not on record	42

1 institutions · 42 of 182 vouchered records shown · 137 without an institution code

09Environmental DNA350 detections

Where the DNA of Aedes koreicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found350

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 350 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 9.00–21.0

Seasonal swing summer↔winter21.6 °C

Max temp (day)21.6 °C 12.4–26.1

Min temp (night)12.2 °C 4.60–16.5

Precipitation74.1 mm/mo 63.8–165

Air humidity57.8 % 55.8–63.4

Moisture balance-20.1 mm/mo -58.6–85.3

Vapour deficit903 Pa 448–1,101

Wind speed2.60 m/s 1.20–3.20

Cloud cover39.0 % 34.0–42.7

CHELSA 1981–2010, ~9 km grid, at location & month of 139 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)