Aedes japonicus

(Theobald, 1901) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records20 957

Data sources10

Biological traits0

DNA specimens789

eDNA detections757

Sources10 archives

Databases and archives Aedes japonicus's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility20 957 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI757 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics789 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF20 957 records

Environmental DNA1 datasets · 14 countries757 detections

DNA & barcodingBOLD789 specimens

Genome at a glanceGoaT · TreeOfSex · NCBI≈1.4 Gbp

01Narrative

Aedes japonicus, commonly known as the Asian bush mosquito or the Asian rock pool mosquito, was first described by Theobald in 1901 from Tokyo, Japan and has four known subspecies Ae. j. japonicus, Ae. j. shintienensis, Ae. j. yaeyamensis, and Ae. j. amamiensus.F. V. Theobald. 1901. A Monograph of the Culicidae or Mosquitoes. London: British Museum (Natural History). Vol. 1: 385; http://www.mosquitocatalog.org/files/pdfs/131700-32.PDF .Michael G. Kaufman and Dina M. Fonseca. 2014. Invasion Biology of Aedes japonicus japonicus (Diptera: Culicidae). Annu. Rev. Entomol., 59: 31–49; http://vectorbio.rutgers.edu/publications/Kaufman2014InvasionBiologyjaponicus.pdf. They are competent arbovirus vectors known to transmit the West Nile virus as well as Japanese and St. Louis encephalitis. They are listed as an invasive species by the Global Invasive Species Database.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding789 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes japonicus has left across the world's sequence archives.

At a glance

DNA specimens789

BINs4

Marker genes6

eDNA detections757

Countries25

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus744 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

139Tmostly conserved

172Tmostly conserved

181Amostly conserved

190Amostly conserved

277Cmostly conserved

316Gvariable

343Tvariable

433Avariable

466Amostly conserved

500Tmostly conserved

634Cvariable

AACTTTATACTTTATTTTTGGTGTTTGATCCGGAATAGTAGGAACATCTTTAAGAATTTTAATTCGTACTGAATTAAGACACCCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.75%

Haplotypes26

BINs4

Most divergent pair9.4%

EuropeN.AmericaAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes notoscriptussame genus8.8%Aedes koreicussame genus8.9%Aedes infirmatussame genus9.4%Aedes tortilissame genus9.9%Aedes rubrithoraxsame genus10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS1★ITS216S18S-5P

animal barcodefungal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_081591 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · TreeOfSex · NCBI

The complete instruction manual Aedes japonicus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 389 713 520 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aedes japonicus1.39 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 6 n = 3

Chromosome records6–62n range6median6mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 64×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Makino, S. (1951). An atlas of the chromosome numbers in Animals. Ames, Iowa, Iowa State College Press. ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type20 957 records

Wild obs. + sensor20 745

Museum / vouchered212

Origin

Introduced1 275

Range

Area of Occupancy AOO9 456 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 7 556≤1 km 275≤10 km 192>10 km 171

8 194 georeferenced · 12 551 without coordinates

Open the mapobservation + sensor20 745

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤100 m 32≤1 km 12≤10 km 4>10 km 1

49 georeferenced · 163 without coordinates

Open the institutions mapphysical evidence212

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UNHClocation not on record	43
LUXEMBOURG, LU	29
Tempe, US	29
Washington, US	13
Ann Arbor, US	6
New Haven, US	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Natural History Museum Rotterdamlocation not on record	2
Saint John, CA	2
CUlocation not on record	1
National Ecological Observatory Network, United Stateslocation not on record	1
East Lansing, US	1
Champaign, US	1

13 institutions · 137 of 212 vouchered records shown · 71 without an institution code

09Environmental DNA757 detections

Where the DNA of Aedes japonicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found757

Studies independent surveys1

Countries14

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 757 detections have coordinates

Open the map14 countries0

Riparian Zone14. Artificial - Terrestrial | 14.2 Pasturel…Mixed habitatevergreenForestForestdeciduousForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 8.30–21.6

Seasonal swing summer↔winter17.7 °C

Max temp (day)19.8 °C 11.9–25.8

Min temp (night)12.7 °C 4.60–17.9

Precipitation75.7 mm/mo 58.1–140

Air humidity60.2 % 57.8–64.2

Moisture balance-21.5 mm/mo -57.7–69.8

Vapour deficit762 Pa 449–1,053

Wind speed3.20 m/s 2.20–4.00

Cloud cover35.8 % 32.0–44.2

CHELSA 1981–2010, ~9 km grid, at location & month of 240 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes japonicus

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type20 957 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type20 957 records