Aedes notoscriptus

(Skuse, 1889) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records4 143

Data sources7

Biological traits0

DNA specimens344

eDNA detections353

Sources7 archives

Databases and archives Aedes notoscriptus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 143 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI353 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics344 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 143 records

Environmental DNA1 datasets · 2 countries353 detections

DNA & barcodingBOLD344 specimens

Genome at a glanceGoaT · NCBI≈900 Mbp

01Narrative

Ochlerotatus notoscriptus est une espèce de moustiques de la famille des Culicidae. Il ressemble beaucoup à Aedes aegypti. C'est un moustique de taille moyenne, de couleur sombre avec des taches blanches sur le corps, des bandes blanches sur les pattes et surtout, à la différence d’Aedes aegypti, une bande blanche médiane sur son proboscis (trompe). On le rencontre pratiquement dans toute l'Australasie mais, en Australie, surtout dans la partie sud-est où il vit en forêt et près des habitations. Il pique les humains dans les zones ombragées et du coucher au lever du soleil. C'est un nuisible qui pourrait transmettre les virus de l'encéphalite de la Murray Valley, de la fièvre de la Ross River et de la forêt de Barmah.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding344 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes notoscriptus has left across the world's sequence archives.

At a glance

DNA specimens344

BINs7

Marker genes14

eDNA detections353

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus42 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 64 variable positions, in barcode order

4Tmostly conserved

13Tmostly conserved

19Tmostly conserved

31Amostly conserved

34Tmostly conserved

40Amostly conserved

56Gvariable

82Cvariable

106Tmostly conserved

115Tmostly conserved

133Tmostly conserved

193Tvariable

199Avariable

206Tvariable

208Amostly conserved

220Cmostly conserved

232Tmostly conserved

271Amostly conserved

280Gmostly conserved

283Tmostly conserved

292Tvariable

298Tvariable

316Avariable

322Avariable

328Amostly conserved

334Tmostly conserved

343Tmostly conserved

346Tmostly conserved

349Cvariable

352Amostly conserved

364Tmostly conserved

370Tmostly conserved

373Amostly conserved

379Amostly conserved

385Tvariable

397Tmostly conserved

400Tmostly conserved

401Tmostly conserved

406Tvariable

421Tvariable

433Amostly conserved

436Tmostly conserved

490Tmostly conserved

493Tmostly conserved

496Tmostly conserved

511Amostly conserved

514Tmostly conserved

530Gmostly conserved

532Avariable

542Cvariable

547Tvariable

553Amostly conserved

562Tmostly conserved

574Tmostly conserved

578Tvariable

580Amostly conserved

589Tmostly conserved

595Tmostly conserved

610Cmostly conserved

616Cvariable

628Amostly conserved

634Cmostly conserved

646Tmostly conserved

653Tmostly conserved

TACTTTATATTTTATTTTTGGTGTTTGATCAGGTATAGTAGGAACTTCTTTAAGAGTTTTAATTCGTACAGAATTAAGTCACCCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.8%

Haplotypes18

BINs7

Most divergent pair9.4%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes cantatorsame genus7.0%Aedes mariaesame genus7.3%Aedes dorsalissame genus7.6%Aedes canadensissame genus7.8%Aedes caspiussame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS218S-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodefungal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_025473 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1large subunit ribosomal RNAsmall subunit ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aedes notoscriptus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈900 425 932 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aedes notoscriptus0.90 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type4 143 records

Wild obs. + sensor2 191

Museum / vouchered1 952

Range

Area of Occupancy AOO6 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 955≤1 km 251≤10 km 165>10 km 425

1 796 georeferenced · 395 without coordinates

Open the mapobservation + sensor2 191

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 2≤1 km 18≤10 km 42>10 km 20

82 georeferenced · 1 870 without coordinates

Open the institutions mapphysical evidence1 952

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natick, US	736
University of Queensland Insect Collectionlocation not on record	734
Wellington, NZ	124
Auckland, NZ	42
San Francisco, US	27
Sydney, AU	16
Australian National Fish Collectionlocation not on record	7
Centre for Biodiversity Genomicslocation not on record	4
Museums Victorialocation not on record	3
DPIlocation not on record	3
Research Collection of Graeme V. Cockslocation not on record	2
Cambridge, US	1

12 institutions · 1 699 of 1 952 vouchered records shown · 19 without an institution code

09Environmental DNA353 detections

Where the DNA of Aedes notoscriptus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found353

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 353 detections have coordinates

Open the map2 countries0

Forest14. Artificial - Terrestrial | 14.5 Urban Ar…open forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median30.7 °C 17.7–30.7

Seasonal swing summer↔winter18.4 °C

Max temp (day)37.2 °C 21.2–37.2

Min temp (night)23.6 °C 14.1–23.6

Precipitation22.7 mm/mo 22.7–85.8

Air humidity39.5 % 39.5–60.1

Moisture balance-225 mm/mo -225–-44.7

Vapour deficit2,682 Pa 856–2,682

Wind speed4.50 m/s 3.70–4.50

Cloud cover31.3 % 30.1–35.8

CHELSA 1981–2010, ~9 km grid, at location & month of 293 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes notoscriptus

At a glance

Sources7 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type4 143 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 143 records