Aedes canadensis

(Theobald, 1901) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records10 805

Data sources9

Biological traits0

DNA specimens436

eDNA detections572

Sources9 archives

Databases and archives Aedes canadensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 805 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI572 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics436 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF10 805 records

Environmental DNA1 datasets · 7 countries572 detections

DNA & barcodingBOLD436 specimens

Genome at a glanceGoaT · TreeOfSex880 Mbp

01Narrative

Aedes canadensis, the woodland pool mosquito, is an aggressive, day biting mosquito that can be a vector of a number of diseases which is found mainly in eastern North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding436 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes canadensis has left across the world's sequence archives.

At a glance

DNA specimens436

BINs3

Marker genes1

eDNA detections572

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus413 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

10Tvariable

40Amostly conserved

85Amostly conserved

88Avariable

220Cmostly conserved

271Tmostly conserved

316Gmostly conserved

319Amostly conserved

340Tmostly conserved

343Cmostly conserved

367Cmostly conserved

433Amostly conserved

562Amostly conserved

565Avariable

589Tvariable

616Tmostly conserved

634Cvariable

646Tmostly conserved

TACATTATATTTTATTTTTGGAGTTTGATCAGGAATAGTAGGAACATCTTTAAGAATTTTAATTCGAGCTGAATTAAGTCAACCAGGAGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 40 commonest of 166 variants.

Diversity (π)1.3%

Haplotypes166

BINs3

Most divergent pair13.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes dorsalissame genus6.5%Aedes decticussame genus6.7%Aedes cantatorsame genus7.0%Aedes turnerisame genus7.0%Aedes aurifersame genus7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Aedes canadensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size880 200 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aedes canadensis0.88 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 6 n = 3

Chromosome records6–62n range6median6mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 65×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Animal Genome Size Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Animal Genome Size Database — ↗

TreeOfSex · invert — Makino, S. (1951). An atlas of the chromosome numbers in Animals. Ames, Iowa, Iowa State College Press. ↗

08Occurrence & distribution

Record type10 805 records

Wild obs. + sensor8 392

Museum / vouchered2 413

Range

Area of Occupancy AOO3 912 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 163≤1 km 45≤10 km 11>10 km 41

260 georeferenced · 8 132 without coordinates

Open the mapobservation + sensor8 392

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 429≤1 km 47≤10 km 413>10 km 60

949 georeferenced · 1 464 without coordinates

Open the institutions mapphysical evidence2 413

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mosquitolocation not on record	1 006
Tempe, US	408
New Haven, US	309
Saint John, CA	245
Champaign, US	79
Ann Arbor, US	56
Edmonton, CA	51
San Francisco, US	48
Wuzhou, CN	45
Vancouver, CA	44
Cambridge, US	29
University of Guelph, Centre for Biodiversity Genomicslocation not on record	26
UNHClocation not on record	21
Chicago, US	8
Cleveland Museum of Natural History, OH (CLEV)location not on record	7
University Park, US	7
CUlocation not on record	6
National Ecological Observatory Network, United Stateslocation not on record	6
WIlocation not on record	3
University of Guelphlocation not on record	2
Denver, US	1
University of Alberta Museums (UAM)location not on record	1
Royal British Columbia Museumlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

24 institutions · 2 410 of 2 413 vouchered records shown · 3 without an institution code

09Environmental DNA572 detections

Where the DNA of Aedes canadensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found572

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 572 detections have coordinates

Open the map7 countries0

woodyWetlandsdeciduousForestmixedForestForestshrubScrubWetland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.5 °C 12.8–26.5

Seasonal swing summer↔winter23.6 °C

Max temp (day)23.8 °C 17.2–29.4

Min temp (night)14.9 °C 8.60–24.8

Precipitation108 mm/mo 81.0–147

Air humidity59.2 % 56.8–62.3

Moisture balance-18.6 mm/mo -54.9–67.7

Vapour deficit904 Pa 658–1,325

Wind speed2.80 m/s 1.90–5.00

Cloud cover38.3 % 26.9–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 541 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes canadensis

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type10 805 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type10 805 records