Aedes aurifer

(Coquillett, 1903) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records416

Data sources6

Biological traits0

DNA specimens45

eDNA detections37

Sources6 archives

Databases and archives Aedes aurifer's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility416 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics45 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF416 records

Environmental DNA1 datasets · 2 countries37 detections

DNA & barcodingBOLD45 specimens

01Narrative

Ochlerotatus aurifer is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1903 door Coquillett.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding45 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes aurifer has left across the world's sequence archives.

At a glance

DNA specimens45

BINs4

Marker genes1

eDNA detections37

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 65 variable positions, in barcode order

43Amostly conserved

49Amostly conserved

50Tmostly conserved

79Tmostly conserved

100Amostly conserved

118Cmostly conserved

133Tmostly conserved

142Tmostly conserved

154Tmostly conserved

193Tmostly conserved

197Cvariable

199Amostly conserved

202Tmostly conserved

206Tmostly conserved

208Amostly conserved

211Amostly conserved

214Avariable

220Cmostly conserved

229Amostly conserved

259Tmostly conserved

266Cmostly conserved

268Tmostly conserved

271Tmostly conserved

277Amostly conserved

283Avariable

286Cmostly conserved

298Tmostly conserved

304Amostly conserved

307Tmostly conserved

316Amostly conserved

322Amostly conserved

328Avariable

337Tmostly conserved

343Tmostly conserved

352Amostly conserved

355Amostly conserved

358Gmostly conserved

364Cvariable

367Tmostly conserved

376Avariable

379Tmostly conserved

412Amostly conserved

416Amostly conserved

418Tmostly conserved

421Tmostly conserved

433Avariable

484Cvariable

499Tmostly conserved

530Gmostly conserved

532Amostly conserved

542Tmostly conserved

548Tvariable

553Tmostly conserved

562Cvariable

565Amostly conserved

578Cmostly conserved

586Amostly conserved

604Amostly conserved

610Cvariable

616Tvariable

619Amostly conserved

622Tmostly conserved

628Avariable

634Cmostly conserved

646Cvariable

AACATTATATTTTATTTTTGGAGTTTGATCAGGAATAGTTGGAACATCATTAAGAATTTTAATTCGTGCTGAATTAAGTCAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes13

BINs4

Most divergent pair5.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes intrudenssame genus4.0%Aedes diantaeussame genus4.3%Aedes decticussame genus4.6%Aedes dorsalissame genus5.6%Aedes communissame genus5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type416 records

Wild obs. + sensor309

Museum / vouchered107

Range

Area of Occupancy AOO304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 2≤10 km 2

4 georeferenced · 305 without coordinates

Open the mapobservation + sensor309

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 60≤10 km 31

91 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence107

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	60
New Haven, US	22
National Ecological Observatory Network, United Stateslocation not on record	10
San Francisco, US	9
NEON Biorepository at Arizona State Universitylocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Cambridge, US	1
Washington, US	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
UNHClocation not on record	1

10 institutions · 107 of 107 vouchered records shown

09Environmental DNA37 detections

Where the DNA of Aedes aurifer was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map2 countries0

Mixed habitatdeciduousForestwoodyWetlandsevergreenForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 9.30–19.5

Seasonal swing summer↔winter26.7 °C

Max temp (day)23.2 °C 13.9–24.4

Min temp (night)13.5 °C 4.70–14.4

Precipitation106 mm/mo 102–115

Air humidity58.3 % 57.5–58.8

Moisture balance-19.1 mm/mo -33.9–20.4

Vapour deficit874 Pa 576–945

Wind speed3.10 m/s 2.60–3.30

Cloud cover39.7 % 38.8–46.1

CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)