Aedes intrudens

Dyar, 1919 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records1 987

Data sources5

Biological traits0

DNA specimens244

eDNA detections6

Sources5 archives

Databases and archives Aedes intrudens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 987 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics244 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 987 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD244 specimens

01Narrative

Ochlerotatus intrudens is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1919 door Dyar.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding244 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes intrudens has left across the world's sequence archives.

At a glance

DNA specimens244

BINs7

Marker genes1

eDNA detections6

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus224 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 48 variable positions, in barcode order

10Cvariable

49Amostly conserved

50Tvariable

76Avariable

88Amostly conserved

100Amostly conserved

142Cmostly conserved

172Cvariable

193Cmostly conserved

202Tmostly conserved

206Cmostly conserved

208Tmostly conserved

220Cmostly conserved

265Amostly conserved

266Cmostly conserved

268Tmostly conserved

280Gmostly conserved

286Cmostly conserved

289Amostly conserved

295Amostly conserved

298Tmostly conserved

316Amostly conserved

322Amostly conserved

328Amostly conserved

334Avariable

340Cmostly conserved

343Tmostly conserved

352Amostly conserved

364Amostly conserved

379Tmostly conserved

412Avariable

415Tmostly conserved

418Avariable

421Tmostly conserved

424Amostly conserved

433Amostly conserved

472Cmostly conserved

473Gmostly conserved

514Amostly conserved

530Gmostly conserved

532Amostly conserved

562Cvariable

578Cmostly conserved

586Amostly conserved

604Amostly conserved

616Tvariable

634Cmostly conserved

646Tmostly conserved

AACATTATACTTTATTTTCGGAGTTTGATCAGGAATAGTTGGAACATCATTAAGAATTTTAATTCGTGCTGAATTAAGTCAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 64 variants.

Diversity (π)2.5%

Haplotypes64

BINs7

Most divergent pair12.5%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes aurifersame genus4.0%Aedes decticussame genus4.9%Aedes dorsalissame genus5.3%Aedes camptorhynchussame genus5.8%Aedes thibaultisame genus5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 987 records

Wild obs. + sensor242

Museum / vouchered1 745

Range

Area of Occupancy AOO1 168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 59≤1 km 4

63 georeferenced · 179 without coordinates

Open the mapobservation + sensor242

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 1 194≤1 km 161≤10 km 131>10 km 68

1 554 georeferenced · 191 without coordinates

Open the institutions mapphysical evidence1 745

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	827
Edmonton, CA	727
Saint John, CA	60
Wuzhou, CN	36
Vancouver, CA	26
National Ecological Observatory Network, United Stateslocation not on record	19
UNHClocation not on record	14
New Haven, US	13
NEON Biorepository at Arizona State Universitylocation not on record	7
San Francisco, US	3
WIlocation not on record	1
University of Alberta Museums (UAM)location not on record	1
NARlocation not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
Mohonk Preserve, Inc.location not on record	1

15 institutions · 1 737 of 1 745 vouchered records shown · 8 without an institution code

09Environmental DNA6 detections

Where the DNA of Aedes intrudens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

deciduousForestmixedForestevergreenForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.3 °C 13.4–19.7

Seasonal swing summer↔winter29.3 °C

Max temp (day)20.8 °C 18.7–24.8

Min temp (night)11.8 °C 8.10–14.4

Precipitation110 mm/mo 94.1–121

Air humidity57.1 % 54.7–59.6

Moisture balance-14.0 mm/mo -43.6–-6.60

Vapour deficit783 Pa 678–987

Wind speed3.00 m/s 1.80–3.20

Cloud cover43.4 % 39.7–45.2

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes intrudens

At a glance

Sources5 archives

At a glance

Record type1 987 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 987 records