Aedes thibaulti

Dyar & Knab, 1910 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records251

Data sources5

Biological traits0

DNA specimens5

eDNA detections8

Sources5 archives

Databases and archives Aedes thibaulti's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility251 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF251 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD5 specimens

01Narrative

Ochlerotatus thibaulti is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1910 door Dyar & Knab.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes thibaulti has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.18%

Haplotypes1

BIN1

Where individuals differ — all 2 variable positions, in barcode order

216Gmostly conserved

594Cvariable

ACATTATATTTTATTTTCGGAGTTTGATCAGGAATAGTTGGAACATCATTAAGAATTTTAATTCGTGCTGAATTAAGCCAACCAGGAATA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes aurifersame genus5.6%Aedes intrudenssame genus5.8%Aedes camptorhynchussame genus6.2%Aedes dorsalissame genus6.5%Aedes decticussame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type251 records

Wild obs. + sensor221

Museum / vouchered30

Origin

Native3

Range

Area of Occupancy AOO304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 220 without coordinates

Open the mapobservation + sensor221

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 4≤1 km 7≤10 km 11

22 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	15
Tempe, US	4
Los Angeles, US	3
Cornell University Insect Collectionlocation not on record	3
Cambridge, US	2
Champaign, US	2
NEON Biorepository at Arizona State Universitylocation not on record	1

7 institutions · 30 of 30 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Aedes thibaulti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

mixedForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.5 °C 17.7–22.1

Seasonal swing summer↔winter20.9 °C

Max temp (day)23.1 °C 19.5–24.6

Min temp (night)18.3 °C 15.4–20.5

Precipitation97.2 mm/mo 88.7–105

Air humidity62.8 % 60.5–63.2

Moisture balance-59.9 mm/mo -89.9–-45.7

Vapour deficit942 Pa 754–983

Wind speed5.00 m/s 2.50–5.30

Cloud cover37.7 % 35.9–39.3

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)