Aedes camptorhynchus

(Thomson, 1869) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records560

Data sources9

Biological traits0

DNA specimens49

eDNA detections46

Sources9 archives

Databases and archives Aedes camptorhynchus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility560 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI46 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF560 records

Environmental DNA1 datasets · 1 countries46 detections

DNA & barcodingBOLD49 specimens

Genome at a glanceGoaT · NCBI≈1.1 Gbp

01Narrative

Aedes camptorhynchus, the southern saltmarsh mosquito, is responsible for transmitting the Ross River virus, which causes Ross River fever. The mosquito had become established in New Zealand, after it was accidentally transported from Australia to Hawke’s Bay, in 1998 from where it dispersed to another 10 localities mainly on the North Island. It was declared to be eradicated in 2010.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes camptorhynchus has left across the world's sequence archives.

At a glance

DNA specimens49

BINs1

Marker genes2

eDNA detections46

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus45 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

133Tmostly conserved

343Cvariable

412Gvariable

415Avariable

631Gvariable

TACATTATACTTTATTTTCGGAGTTTGATCAGGAATAGTTGGAACATCATTAAGAATCTTAATTCGTGCTGAATTAAGCCAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes3

BIN1

Most divergent pair0.61%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes dorsalissame genus5.0%Aedes caspiussame genus5.0%Aedes zammitiisame genus5.3%Aedes mariaesame genus5.4%Aedes ratcliffeisame genus5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aedes camptorhynchus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 079 575 157 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aedes camptorhynchus1.08 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type560 records

Wild obs. + sensor367

Museum / vouchered193

Range

Area of Occupancy AOO1 300 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 179≤1 km 43≤10 km 8>10 km 47

277 georeferenced · 90 without coordinates

Open the mapobservation + sensor367

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 5≤1 km 2≤10 km 28

35 georeferenced · 158 without coordinates

Open the institutions mapphysical evidence193

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Queensland Insect Collectionlocation not on record	86
Natick, US	67
Museums Victorialocation not on record	14
QVMAGlocation not on record	12
Australian National Fish Collectionlocation not on record	7
Auckland, NZ	6
Tasmanian Museum & Art Gallerylocation not on record	1

7 institutions · 193 of 193 vouchered records shown

09Environmental DNA46 detections

Where the DNA of Aedes camptorhynchus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found46

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 46 detections have coordinates

Open the map1 country0

14. Artificial - Terrestrial | 14.5 Urban Ar…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 13.5–21.9

Seasonal swing summer↔winter9.10 °C

Max temp (day)21.0 °C 15.7–28.5

Min temp (night)13.4 °C 11.1–15.0

Precipitation67.0 mm/mo 15.6–158

Air humidity55.4 % 43.4–58.5

Moisture balance-56.3 mm/mo -143–89.0

Vapour deficit896 Pa 637–1,624

Wind speed4.30 m/s 4.00–5.80

Cloud cover17.0 % 14.6–21.8

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)