Aedes caspius

(Pallas, 1771) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records10 686

Data sources7

Biological traits2

DNA specimens295

eDNA detections501

Sources7 archives

Databases and archives Aedes caspius's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 686 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI501 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics295 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF10 686 records

Environmental DNA5 datasets · 25 countries501 detections

DNA & barcodingBOLD295 specimens

Genome at a glanceGoaT968 Mbp

01Narrative

Aedes caspius est un Culicidae originaire d'Europe. Il est largement répandu en Camargue, où il peut produire de graves nuisances. Les nuisances occasionnées peuvent être importantes, pouvant aller localement jusqu'à la fermeture d'écoles comme ce fut le cas en septembre 2005 en France dans l'ouest du littoral méditerranéen. C'est un petit moustique long de 5 mm environ, globalement roux avec des bandes longitudinales claires sur le thorax et des bandes blanches sur les pattes. La femelle, qui est la seule hématophage, ne pique pratiquement que les mammifères.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)haematophagous

Feeding guild (larval)saprophagous

05DNA & barcoding295 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes caspius has left across the world's sequence archives.

At a glance

DNA specimens295

BINs6

Marker genes4

eDNA detections501

Countries25

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus274 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

56Avariable

184Avariable

220Amostly conserved

226Cmostly conserved

298Tmostly conserved

307Avariable

316Gvariable

328Amostly conserved

370Amostly conserved

376Cmostly conserved

382Tvariable

508Tmostly conserved

514Tmostly conserved

562Tmostly conserved

577Amostly conserved

580Amostly conserved

613Tvariable

616Cmostly conserved

634Tmostly conserved

641Cmostly conserved

646Tmostly conserved

TACATTATATTTTATTTTCGGAGTTTGATCAGGAATAGTTGGAACATCATTAAGAATTTTAATTCGTGCTGAATTAAGTCAACCAGGTAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 74 variants.

Diversity (π)1.5%

Haplotypes74

BINs6

Most divergent pair3.2%

EuropeAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes mariaesame genus1.6%Aedes dorsalissame genus1.8%Aedes zammitiisame genus2.0%Aedes phoeniciaesame genus3.0%Aedes melanimonsame genus3.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS216S

animal barcodefungal barcoderibosomal

06Genome at a glanceGoaT

The complete instruction manual Aedes caspius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size968 220 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aedes caspius0.97 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 6 n = 3

Chromosome records6–62n range6median6mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 62×GoaT · Animal Chromosome Counts Database · GoaT · Animal Genome Size Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Animal Genome Size Database — ↗

08Occurrence & distribution

Record type10 686 records

Wild obs. + sensor9 769

Museum / vouchered915

Other2

Origin

Native32

Range

Area of Occupancy AOO10 104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy6% within 1 km

≤100 m 190≤1 km 77≤10 km 4 420>10 km 6

4 693 georeferenced · 5 076 without coordinates

Open the mapobservation + sensor9 769

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 17≤1 km 7≤10 km 3

27 georeferenced · 888 without coordinates

Open the institutions mapphysical evidence915

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	764
South Kensington, GB	24
Centro de Investigacion Biomedica de La Riojalocation not on record	4
RBINS-Scientific Heritagelocation not on record	4
Animal and Plant Health Agency, UKlocation not on record	3
Tartu, EE	3
Royal Belgian Institute of Natural Scienceslocation not on record	2
Sevilla, ES	2
University of Queensland Insect Collectionlocation not on record	1
PPlocation not on record	1
ITGlocation not on record	1
SPblocation not on record	1
SLU Artdatabankenlocation not on record	1

13 institutions · 811 of 915 vouchered records shown · 99 without an institution code

09Environmental DNA501 detections

Where the DNA of Aedes caspius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found501

Studies independent surveys5

Countries25

Verifiable raw sequence linked116

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 501 detections have coordinates

Open the map25 countries0

FarmlandsSalt MarshFamily-run diary and arable farmGrazing areas on fenland3. Shrubland|3.5. Subtropical/Tropical Dry S…Olive orchard

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH6.30 5.70–7.70

Conductivity50.0 µS/cm 18.0–89.0

Organic carbon1.07 % 0.68–4.08

Water content25.6 % 19.7–31.5

Nitrate-N5.00 mg/kg 2.00–10.0

Phosphorus6.00 mg/kg 3.00–65.0

Clay45.3 % 18.2–67.0

Sand38.6 % 2.00–65.6

Depth0.2 m 0–0.2

air [ENVO:00002005]SoilTenosolsDermosolsHydrosolVertosol

5 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 11.8–22.0

Seasonal swing summer↔winter18.3 °C

Max temp (day)20.8 °C 16.2–27.6

Min temp (night)13.9 °C 7.20–16.2

Precipitation63.4 mm/mo 5.50–84.4

Air humidity59.9 % 42.9–63.0

Moisture balance-57.8 mm/mo -151–-9.70

Vapour deficit796 Pa 614–1,821

Wind speed3.50 m/s 2.40–4.50

Cloud cover42.9 % 21.6–48.1

CHELSA 1981–2010, ~9 km grid, at location & month of 315 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes caspius

At a glance

Sources7 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type10 686 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type10 686 records