Aedes melanimon

Dyar, 1924 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records1 990

Data sources5

Biological traits0

DNA specimens36

eDNA detections32

Sources5 archives

Databases and archives Aedes melanimon's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 990 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 990 records

Environmental DNA1 datasets · 2 countries32 detections

DNA & barcodingBOLD36 specimens

01Narrative

Ochlerotatus melanimon is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1924 door Dyar.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes melanimon has left across the world's sequence archives.

At a glance

DNA specimens36

BINs1

Marker genes1

eDNA detections32

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

22Amostly conserved

31Gmostly conserved

328Amostly conserved

409Gvariable

418Amostly conserved

433Amostly conserved

556Tmostly conserved

577Amostly conserved

589Tmostly conserved

634Cmostly conserved

TACATTATATTTTATTTTCGGAGTTTGATCGGGAATAGTTGGAACATCTTTAAGAGTTTTAATTCGTGCTGAATTAAGTCAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.48%

Haplotypes20

BIN1

Most divergent pair1.4%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes dorsalissame genus3.2%Aedes caspiussame genus3.2%Aedes zammitiisame genus3.5%Aedes mariaesame genus3.6%Aedes campestrissame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 990 records

Wild obs. + sensor1 859

Museum / vouchered131

Range

Area of Occupancy AOO1 036 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 9>10 km 4

13 georeferenced · 1 846 without coordinates

Open the mapobservation + sensor1 859

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 55≤1 km 2≤10 km 62>10 km 1

120 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence131

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Francisco, US	57
Tempe, US	50
UNHClocation not on record	8
San Nicolás de los Garza, MX	5
Champaign, US	4
CUlocation not on record	2
Vancouver, CA	2
Denver, US	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
University Park, US	1

10 institutions · 131 of 131 vouchered records shown

09Environmental DNA32 detections

Where the DNA of Aedes melanimon was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map2 countries0

shrubScrub4. Native GrasslandGrasslandgrasslandHerbaceous

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 9.10–23.2

Seasonal swing summer↔winter23.9 °C

Max temp (day)25.8 °C 16.4–30.2

Min temp (night)11.6 °C 3.40–15.7

Precipitation40.8 mm/mo 28.9–52.8

Air humidity50.3 % 47.5–52.2

Moisture balance-112 mm/mo -139–-66.7

Vapour deficit1,044 Pa 668–1,556

Wind speed3.70 m/s 2.40–4.10

Cloud cover29.8 % 20.4–38.2

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes melanimon

At a glance

Sources5 archives

At a glance

Record type1 990 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 990 records