Aedes communis

(De Geer, 1776) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records7 650

Data sources6

Biological traits2

DNA specimens898

eDNA detections3 218

Sources6 archives

Databases and archives Aedes communis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 650 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 218 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics898 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF7 650 records

Environmental DNA9 datasets · 15 countries3 218 detections

DNA & barcodingBOLD898 specimens

01Narrative

Aedes communis also known as the woodland snow pool mosquito is a species of mosquito in the genus Aedes. It is common in New Jersey but can also be found in the Northern United States, Canada and Alaska. It is a known pollinator of Platanthera obtusata. Unlike other mosquito species, Aedes communis remains active during the winter.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)haematophagous

Feeding guild (larval)saprophagous

05DNA & barcoding898 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes communis has left across the world's sequence archives.

At a glance

DNA specimens898

BINs8

Marker genes3

eDNA detections3 218

Countries15

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus820 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 35 variable positions, in barcode order

38Gmostly conserved

43Avariable

49Avariable

133Amostly conserved

154Tvariable

181Amostly conserved

199Avariable

202Tvariable

211Avariable

220Cvariable

266Cvariable

268Tvariable

283Gvariable

289Cvariable

290Cmostly conserved

295Tvariable

304Gmostly conserved

316Avariable

322Gvariable

337Gvariable

358Avariable

364Tmostly conserved

416Avariable

418Tvariable

490Tmostly conserved

499Tvariable

536Cvariable

541Avariable

542Tvariable

562Cvariable

589Cvariable

592Amostly conserved

622Tmostly conserved

634Tvariable

649Amostly conserved

AACATTATATTTTATTTTCGGAGTTTGATCAGGAATAGTTGGAACATCATTAAGAATTTTAATTCGTGCTGAATTAAGACAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 106 variants.

Diversity (π)2.6%

Haplotypes106

BINs8

Most divergent pair9.9%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes churchillensissame genus3.8%Aedes tahoensissame genus4.0%Aedes ventrovittissame genus4.1%Aedes punctorsame genus4.3%Aedes hexodontussame genus4.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS216S

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type7 650 records

Wild obs. + sensor934

Museum / vouchered6 716

Origin

Native4

Range

Area of Occupancy AOO3 644 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 315≤1 km 37≤10 km 11

363 georeferenced · 571 without coordinates

Open the mapobservation + sensor934

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 3 350≤1 km 1 233≤10 km 975>10 km 194

5 752 georeferenced · 964 without coordinates

Open the institutions mapphysical evidence6 716

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	2 651
Edmonton, CA	2 354
MZLUlocation not on record	442
Vancouver, CA	312
University of Guelph, Centre for Biodiversity Genomicslocation not on record	233
Saint John, CA	138
WIlocation not on record	119
UNHClocation not on record	87
National Ecological Observatory Network, United Stateslocation not on record	69
New Haven, US	64
San Francisco, US	58
Wuzhou, CN	57
CUlocation not on record	21
SLU Artdatabankenlocation not on record	19
NEON Biorepository at Arizona State Universitylocation not on record	6
Washington, US	4
Los Angeles, US	4
South Kensington, GB	3
DOI/FWS, Kenai National Wildlife Refugelocation not on record	2
St. Paul, US	1
Ugentlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Mosquitolocation not on record	1
ITGlocation not on record	1
Centre for Biodiversity Genomics, Informatics Departmentlocation not on record	1
NCMGlocation not on record	1
Mohonk Preserve, Inc.location not on record	1
Provincia di Ascoli Picenolocation not on record	1

28 institutions · 6 652 of 6 716 vouchered records shown · 64 without an institution code

09Environmental DNA3 218 detections

Where the DNA of Aedes communis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3 218

Studies independent surveys9

Countries15

Verifiable raw sequence linked1 572

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 218 detections have coordinates

Open the map15 countries0

1.1 Boreal ForestRiparian ZoneSpruce, fireline5. Wetlands (inland) | 5.1. Permanent Rivers…5. Wetlands (inland) | 5.15. Seasonal/Interm…evergreenForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.8 °C 5.20–14.9

Seasonal swing summer↔winter24.1 °C

Max temp (day)15.1 °C 9.10–19.2

Min temp (night)6.40 °C 1.80–11.2

Precipitation65.6 mm/mo 40.9–112

Air humidity58.3 % 55.1–65.3

Moisture balance-33.2 mm/mo -60.2–10.2

Vapour deficit549 Pa 308–736

Wind speed2.60 m/s 2.10–3.90

Cloud cover48.3 % 38.5–55.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 157 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes communis

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type7 650 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 650 records