Aedes hexodontus

Dyar, 1916 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records2 240

Data sources6

Biological traits0

DNA specimens446

eDNA detections12

Sources6 archives

Databases and archives Aedes hexodontus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 240 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics446 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 240 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD446 specimens

01Narrative

Ochlerotatus hexodontus is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1916 door Harrison Gray Dyar. Deze muggen komen in de lente uit in ondiepe poelen, in de streek rond Lake Tahoe, Californië.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding446 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes hexodontus has left across the world's sequence archives.

At a glance

DNA specimens446

BINs8

Marker genes1

eDNA detections12

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus381 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 50 variable positions, in barcode order

1Gmostly conserved

25Tmostly conserved

43Amostly conserved

49Amostly conserved

88Amostly conserved

139Cmostly conserved

148Amostly conserved

166Avariable

181Avariable

202Cmostly conserved

214Amostly conserved

217Amostly conserved

220Avariable

229Gmostly conserved

232Tmostly conserved

235Tmostly conserved

244Amostly conserved

262Gvariable

277Cvariable

289Gmostly conserved

295Tvariable

298Tmostly conserved

313Tmostly conserved

316Gmostly conserved

319Amostly conserved

328Tmostly conserved

337Gmostly conserved

343Amostly conserved

358Amostly conserved

364Cmostly conserved

373Amostly conserved

412Tvariable

415Gmostly conserved

421Tmostly conserved

451Tmostly conserved

466Amostly conserved

475Amostly conserved

478Gvariable

490Tmostly conserved

493Amostly conserved

514Cmostly conserved

536Tmostly conserved

538Amostly conserved

541Amostly conserved

550Amostly conserved

562Cmostly conserved

601Tmostly conserved

628Gvariable

634Cmostly conserved

646Cmostly conserved

GACATTATATTTTATTTTCGGAGTTTGATCTGGAATAGTTGGAACATCATTAAGAATTTTAATTCGTGCTGAATTAAGACAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 113 variants.

Diversity (π)2.6%

Haplotypes113

BINs8

Most divergent pair10.6%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes aboriginissame genus2.0%Aedes ventrovittissame genus4.1%Aedes communissame genus4.4%Aedes churchillensissame genus5.9%Aedes tahoensissame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 240 records

Wild obs. + sensor119

Museum / vouchered2 121

Range

Area of Occupancy AOO872 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 1

5 georeferenced · 114 without coordinates

Open the mapobservation + sensor119

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 1 338≤1 km 100≤10 km 431>10 km 6

1 875 georeferenced · 246 without coordinates

Open the institutions mapphysical evidence2 121

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	1 317
Edmonton, CA	524
University of Guelph, Centre for Biodiversity Genomicslocation not on record	72
National Ecological Observatory Network, United Stateslocation not on record	60
Vancouver, CA	59
San Francisco, US	44
New Haven, US	11
UNHClocation not on record	8
Université de Montréallocation not on record	5
University of Alberta Museums (UAM)location not on record	1
University of Queensland Insect Collectionlocation not on record	1
NEON Biorepository at Arizona State Universitylocation not on record	1
Washington, US	1
MZLUlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
Provincia di Ascoli Picenolocation not on record	1
Mohonk Preserve, Inc.location not on record	1

17 institutions · 2 108 of 2 121 vouchered records shown · 13 without an institution code

09Environmental DNA12 detections

Where the DNA of Aedes hexodontus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

sedgeHerbaceousdwarfScrubevergreenForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.0 °C 10.9–24.0

Seasonal swing summer↔winter18.4 °C

Max temp (day)30.8 °C 14.7–30.8

Min temp (night)16.8 °C 7.20–16.8

Precipitation6.70 mm/mo 6.70–94.9

Air humidity47.4 % 47.4–62.1

Moisture balance-163 mm/mo -163–10.2

Vapour deficit1,565 Pa 498–1,565

Wind speed1.00 m/s 1.00–3.90

Cloud cover11.6 % 11.6–74.0

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes hexodontus

At a glance

Sources6 archives

At a glance

Record type2 240 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 240 records