Aedes punctor

(Kirby, 1837) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records4 495

Data sources6

Biological traits2

DNA specimens467

eDNA detections19

Sources6 archives

Databases and archives Aedes punctor's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 495 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics467 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF4 495 records

Environmental DNA1 datasets · 3 countries19 detections

DNA & barcodingBOLD467 specimens

01Narrative

Ochlerotatus punctor is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1837 door Kirby.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)haematophagous

Feeding guild (larval)saprophagous

05DNA & barcoding467 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes punctor has left across the world's sequence archives.

At a glance

DNA specimens467

BINs7

Marker genes2

eDNA detections19

Countries14

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus391 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 53 variable positions, in barcode order

1Gvariable

10Tmostly conserved

25Tmostly conserved

31Tmostly conserved

40Tmostly conserved

49Amostly conserved

88Amostly conserved

139Cmostly conserved

148Avariable

160Amostly conserved

166Avariable

181Avariable

202Cmostly conserved

217Amostly conserved

220Avariable

229Gmostly conserved

232Tmostly conserved

235Tmostly conserved

244Amostly conserved

262Gmostly conserved

277Cvariable

289Gmostly conserved

295Tvariable

298Tmostly conserved

316Gvariable

319Amostly conserved

328Tmostly conserved

337Gmostly conserved

343Amostly conserved

358Amostly conserved

364Cvariable

370Amostly conserved

373Avariable

412Tvariable

415Gmostly conserved

421Tmostly conserved

433Amostly conserved

466Avariable

478Gvariable

490Tmostly conserved

493Amostly conserved

508Amostly conserved

514Cmostly conserved

536Tmostly conserved

541Amostly conserved

547Cmostly conserved

550Amostly conserved

562Cmostly conserved

583Amostly conserved

619Tmostly conserved

622Tmostly conserved

628Amostly conserved

646Cmostly conserved

GACATTATATTTTATTTTCGGAGTTTGATCTGGAATAGTTGGAACATCATTAAGAATTTTAATTCGTGCTGAATTAAGACAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 80 variants.

Diversity (π)2.9%

Haplotypes80

BINs7

Most divergent pair11.9%

N.AmericaEuropeS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes aboriginissame genus1.8%Aedes ventrovittissame genus4.0%Aedes communissame genus4.3%Aedes churchillensissame genus5.8%Aedes tahoensissame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type4 495 records

Wild obs. + sensor814

Museum / vouchered3 681

Range

Area of Occupancy AOO3 404 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 257≤1 km 69≤10 km 85>10 km 5

416 georeferenced · 398 without coordinates

Open the mapobservation + sensor814

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 2 286≤1 km 377≤10 km 457>10 km 60

3 180 georeferenced · 501 without coordinates

Open the institutions mapphysical evidence3 681

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	1 732
Edmonton, CA	1 223
Saint John, CA	163
Vancouver, CA	101
South Kensington, GB	89
MZLUlocation not on record	80
National Ecological Observatory Network, United Stateslocation not on record	46
Animal and Plant Health Agency, UKlocation not on record	24
Wuzhou, CN	24
San Francisco, US	18
New Haven, US	13
SLU Artdatabankenlocation not on record	10
NCMGlocation not on record	9
NEON Biorepository at Arizona State Universitylocation not on record	8
WIlocation not on record	7
UNHClocation not on record	7
CUlocation not on record	5
Université de Montréallocation not on record	5
Washington, US	4
Champaign, US	3
St. Paul, US	3
University of Queensland Insect Collectionlocation not on record	3
Ann Arbor, US	3
BMNHlocation not on record	3
NARlocation not on record	2
Mosquitolocation not on record	2
University of Alberta Museums (UAM)location not on record	1
DFFW1981location not on record	1
Mohonk Preserve, Inc.location not on record	1
ITGlocation not on record	1

30 institutions · 3 591 of 3 681 vouchered records shown · 89 without an institution code

09Environmental DNA19 detections

Where the DNA of Aedes punctor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map3 countries0

woodyWetlandsshrubScrubdeciduousForestevergreenForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 8.30–18.1

Seasonal swing summer↔winter29.7 °C

Max temp (day)22.1 °C 11.9–23.5

Min temp (night)12.9 °C 4.60–15.2

Precipitation103 mm/mo 59.3–108

Air humidity58.4 % 57.7–63.6

Moisture balance-31.4 mm/mo -35.5–0.6

Vapour deficit796 Pa 449–840

Wind speed2.90 m/s 2.60–3.30

Cloud cover42.6 % 38.5–56.7

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes punctor

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type4 495 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 495 records