Aedes cantator

(Coquillett, 1903) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records1 064

Data sources6

Biological traits0

DNA specimens32

eDNA detections0

Sources6 archives

Databases and archives Aedes cantator's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 064 records↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 064 records

DNA & barcodingBOLD32 specimens

01Narrative

Ochlerotatus cantator, the brown saltmarsh mosquito, is a species of mosquito from the genus Ochlerotatus. It was formerly known as Aedes cantator. Several Aedes species have been reclassified as Ochlerotatus, O. cantator being one of them. Its habitat is marshes and pools. They are found in the Maritime Provinces of Canada, New England and the American Mid-Atlantic States. It is the most common species of mosquito in many parts of New Brunswick and Maine. It bites humans and can carry West Nile virus and Eastern equine encephalitis. It has short, budlike anal gills.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes cantator has left across the world's sequence archives.

At a glance

DNA specimens32

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

36Tmostly conserved

39Tmostly conserved

76Amostly conserved

187Tmostly conserved

220Tvariable

271Tvariable

508Amostly conserved

583Gvariable

616Cmostly conserved

634Cmostly conserved

AACATTATATTTTATTTTTGGAGTTTGATCAGGAATAGTAGGAACATCTTTAAGTATTTTAATTCGAGCAGAATTAAGTCAACCAGGTAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.74%

Haplotypes11

BIN1

Most divergent pair1.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes dorsalissame genus5.9%Aedes caspiussame genus5.9%Aedes zammitiisame genus6.3%Aedes campestrissame genus6.5%Aedes ventrovittissame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 064 records

Wild obs. + sensor466

Museum / vouchered598

Range

Area of Occupancy AOO824 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 9≤1 km 5≤10 km 3

17 georeferenced · 449 without coordinates

Open the mapobservation + sensor466

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 23≤1 km 26≤10 km 173>10 km 3

225 georeferenced · 373 without coordinates

Open the institutions mapphysical evidence598

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mosquitolocation not on record	251
New Haven, US	163
Saint John, CA	93
UNHClocation not on record	40
Tempe, US	20
Cleveland Museum of Natural History, OH (CLEV)location not on record	9
National Ecological Observatory Network, United Stateslocation not on record	5
Wuzhou, CN	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Cambridge, US	4
San Francisco, US	2
University of Guelphlocation not on record	1
Vancouver, CA	1
Washington, US	1

14 institutions · 598 of 598 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes cantator

At a glance

Sources6 archives

At a glance

Record type1 064 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 14 geolocated

Record type1 064 records