Aedes tortilis

(Theobald, 1903) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records726

Data sources4

Biological traits0

DNA specimens105

eDNA detections76

Sources4 archives

Databases and archives Aedes tortilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility726 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI76 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics105 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF726 records

Environmental DNA1 datasets · 2 countries76 detections

DNA & barcodingBOLD105 specimens

01Narrative

Ochlerotatus tortilis is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1903 door Theobald.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding105 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes tortilis has left across the world's sequence archives.

At a glance

DNA specimens105

BINs3

Marker genes2

eDNA detections76

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus101 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

100Amostly conserved

271Cmostly conserved

304Amostly conserved

316Gmostly conserved

322Amostly conserved

340Tmostly conserved

343Amostly conserved

358Amostly conserved

373Amostly conserved

407Cmostly conserved

415Tmostly conserved

418Amostly conserved

514Avariable

562Amostly conserved

565Amostly conserved

578Tmostly conserved

634Cmostly conserved

637Tmostly conserved

AACCTTATATTTTATCTTCGGAGTTTGATCAGGAATAGTTGGAACATCATTAAGAATTTTAATTCGTGCTGAATTAAGTCAACCAGGTAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes40

BINs3

Most divergent pair9.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes infirmatussame genus5.3%Aedes angustivittatussame genus5.7%Aedes dorsalissame genus5.8%Aedes caspiussame genus5.8%Aedes obturbatorsame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2

animal barcodefungal barcode

08Occurrence & distribution

Record type726 records

Wild obs. + sensor204

Museum / vouchered522

Range

Area of Occupancy AOO224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 201 without coordinates

Open the mapobservation + sensor204

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 374

374 georeferenced · 148 without coordinates

Open the institutions mapphysical evidence522

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	392
Washington, US	122
Mayagüez, PR	5
NEON Biorepository at Arizona State Universitylocation not on record	1
University of Queensland Insect Collectionlocation not on record	1
Ann Arbor, US	1

6 institutions · 522 of 522 vouchered records shown

09Environmental DNA76 detections

Where the DNA of Aedes tortilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found76

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 76 detections have coordinates

Open the map2 countries0

forest near bungalowspastureHaygrasslandHerbaceousevergreenForestcultivatedCrops

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.5 °C 25.8–27.8

Seasonal swing summer↔winter2.60 °C

Max temp (day)29.0 °C 27.6–30.0

Min temp (night)25.0 °C 24.2–26.1

Precipitation133 mm/mo 69.8–227

Air humidity61.5 % 60.1–63.4

Vapour deficit1,355 Pa 1,291–1,407

Cloud cover27.1 % 24.6–31.4

CHELSA 1981–2010, ~9 km grid, at location & month of 73 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)