Aedes infirmatus

Dyar & Knab, 1906 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records21 849

Data sources5

Biological traits0

DNA specimens111

eDNA detections103

Sources5 archives

Databases and archives Aedes infirmatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility21 849 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI103 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics111 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF21 849 records

Environmental DNA1 datasets · 1 countries103 detections

DNA & barcodingBOLD111 specimens

01Narrative

Aedes infirmatus is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1906 door Dyar and Knab.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding111 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes infirmatus has left across the world's sequence archives.

At a glance

DNA specimens111

BINs3

Marker genes2

eDNA detections103

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus110 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

1Amostly conserved

10Cmostly conserved

100Amostly conserved

212Cvariable

220Amostly conserved

266Tmostly conserved

284Tvariable

316Gmostly conserved

328Avariable

373Amostly conserved

418Amostly conserved

457Amostly conserved

485Tmostly conserved

562Amostly conserved

589Cmostly conserved

607Cmostly conserved

628Amostly conserved

641Cmostly conserved

646Cmostly conserved

658Cmostly conserved

AACATTATACTTCATCTTTGGAGTTTGATCAGGAATAGTTGGTACATCATTAAGAATTTTAATTCGTGCTGAATTAAGTCAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 69 variants.

Diversity (π)1.2%

Haplotypes69

BINs3

Most divergent pair8.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes trivittatussame genus2.3%Aedes angustivittatussame genus2.5%Aedes thelctersame genus4.9%Aedes condolescenssame genus5.1%Aedes tortilissame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2

animal barcodefungal barcode

08Occurrence & distribution

Record type21 849 records

Wild obs. + sensor21 253

Museum / vouchered596

Origin

Native3

Range

Area of Occupancy AOO2 096 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 42≤1 km 7≤10 km 2>10 km 6

57 georeferenced · 21 196 without coordinates

Open the mapobservation + sensor21 253

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 511≤1 km 1≤10 km 8>10 km 15

535 georeferenced · 61 without coordinates

Open the institutions mapphysical evidence596

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	494
Ciudad de México, MX	40
San Francisco, US	17
Chicago, US	11
Champaign, US	10
Ann Arbor, US	9
Cambridge, US	4
New Haven, US	3
Los Angeles, US	3
University of Central Floridalocation not on record	2
NEON Biorepository at Arizona State Universitylocation not on record	1
National Ecological Observatory Network, United Stateslocation not on record	1
Armidale, AU	1

13 institutions · 596 of 596 vouchered records shown

09Environmental DNA103 detections

Where the DNA of Aedes infirmatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found103

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 103 detections have coordinates

Open the map1 country0

woodyWetlandsmixedForestdeciduousForestevergreenForestcultivatedCrops

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 15.0–27.0

Seasonal swing summer↔winter14.3 °C

Max temp (day)27.3 °C 20.9–31.6

Min temp (night)18.3 °C 11.2–23.4

Precipitation111 mm/mo 74.4–183

Air humidity60.2 % 58.0–64.0

Moisture balance-3.30 mm/mo -36.6–32.8

Vapour deficit1,091 Pa 747–1,296

Wind speed2.50 m/s 1.80–3.70

Cloud cover34.1 % 31.6–41.0

CHELSA 1981–2010, ~9 km grid, at location & month of 97 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes infirmatus

At a glance

Sources5 archives

At a glance

Record type21 849 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type21 849 records