Aedes trivittatus

(Coquillett, 1902) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records36 502

Data sources6

Biological traits0

DNA specimens1 380

eDNA detections1 369

Sources6 archives

Databases and archives Aedes trivittatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility36 502 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 369 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 380 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF36 502 records

Environmental DNA1 datasets · 3 countries1 369 detections

DNA & barcodingBOLD1 380 specimens

01Narrative

Ochlerotatus trivittatus is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1902 door Coquillett.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 380 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes trivittatus has left across the world's sequence archives.

At a glance

DNA specimens1 380

BINs6

Marker genes2

eDNA detections1 369

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus1 342 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

197Tmostly conserved

304Gmostly conserved

316Amostly conserved

550Cvariable

580Avariable

607Tvariable

628Amostly conserved

634Cmostly conserved

646Tmostly conserved

AACATTATACTTCATCTTTGGAGTTTGATCAGGAATAGTTGGTACATCATTAAGAATTTTAATTCGTGCTGAATTAAGTCAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 40 commonest of 401 variants.

Diversity (π)0.83%

Haplotypes401

BINs5

Most divergent pair5.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes infirmatussame genus2.3%Aedes angustivittatussame genus3.0%Aedes thelctersame genus6.1%Aedes condolescenssame genus6.4%Aedes caballussame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCYTB

animal barcodemitochondrial

08Occurrence & distribution

Record type36 502 records

Wild obs. + sensor34 762

Museum / vouchered1 740

Range

Area of Occupancy AOO5 280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 321≤1 km 80≤10 km 16>10 km 66

483 georeferenced · 34 279 without coordinates

Open the mapobservation + sensor34 762

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 1 321≤1 km 45≤10 km 76>10 km 41

1 483 georeferenced · 257 without coordinates

Open the institutions mapphysical evidence1 740

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	1 325
Champaign, US	84
Ann Arbor, US	78
Wuzhou, CN	49
Ciudad de México, MX	29
East Lansing, US	29
US	25
San Francisco, US	20
Chicago, US	19
Mosquitolocation not on record	18
New Haven, US	12
National Ecological Observatory Network, United Stateslocation not on record	9
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
Washington, US	8
WIlocation not on record	7
NEON Biorepository at Arizona State Universitylocation not on record	7
Universidad Autonoma Agraria Antonio Narrolocation not on record	3
Denver, US	2
Universidad Autonoma Agraria Antonio Narro, Unidad Lagunalocation not on record	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
San Nicolás de los Garza, MX	2
CUlocation not on record	1
Animal and Plant Health Agency, UKlocation not on record	1

23 institutions · 1 740 of 1 740 vouchered records shown

09Environmental DNA1 369 detections

Where the DNA of Aedes trivittatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 369

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 369 detections have coordinates

Open the map3 countries0

grasslandHerbaceousevergreenForestpastureHaycultivatedCropsdeciduousForestmixedForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.9 °C 10.0–24.8

Seasonal swing summer↔winter26.1 °C

Max temp (day)24.2 °C 15.6–29.9

Min temp (night)14.8 °C 5.30–19.9

Precipitation100 mm/mo 55.8–125

Air humidity57.6 % 52.0–60.9

Moisture balance-35.5 mm/mo -97.2–17.8

Vapour deficit944 Pa 584–1,368

Wind speed3.10 m/s 1.90–4.90

Cloud cover37.0 % 25.3–43.8

CHELSA 1981–2010, ~9 km grid, at location & month of 366 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes trivittatus

At a glance

Sources6 archives

At a glance

Record type36 502 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type36 502 records