Aedes pullatus

(Coquillett, 1904) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records747

Data sources6

Biological traits0

DNA specimens145

eDNA detections193

Sources6 archives

Databases and archives Aedes pullatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility747 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI193 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics145 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF747 records

Environmental DNA4 datasets · 5 countries193 detections

DNA & barcodingBOLD145 specimens

01Narrative

Ochlerotatus pullatus is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1904 door Coquillett.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding145 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes pullatus has left across the world's sequence archives.

At a glance

DNA specimens145

BINs4

Marker genes2

eDNA detections193

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus119 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

19Cmostly conserved

181Avariable

187Cvariable

212Cvariable

259Tmostly conserved

283Cmostly conserved

289Avariable

307Gmostly conserved

358Amostly conserved

382Tmostly conserved

421Avariable

500Tmostly conserved

508Avariable

532Amostly conserved

562Cmostly conserved

577Amostly conserved

589Cmostly conserved

616Cmostly conserved

634Cmostly conserved

AACATTATATTTTATTTTCGGAGTTTGATCAGGAATAGTTGGTACATCATTAAGAATTTTAATTCGTGCTGAATTAAGACAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 43 variants.

Diversity (π)1.5%

Haplotypes43

BINs4

Most divergent pair8.8%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes ventrovittissame genus5.3%Aedes caspiussame genus5.5%Aedes dorsalissame genus5.6%Aedes communissame genus6.1%Aedes caballussame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type747 records

Wild obs. + sensor149

Museum / vouchered598

Range

Area of Occupancy AOO720 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 2

5 georeferenced · 144 without coordinates

Open the mapobservation + sensor149

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 319≤1 km 58≤10 km 28>10 km 6

411 georeferenced · 187 without coordinates

Open the institutions mapphysical evidence598

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	320
Vancouver, CA	124
Edmonton, CA	52
San Francisco, US	44
Wuzhou, CN	25
National Ecological Observatory Network, United Stateslocation not on record	22
UNHClocation not on record	4
DOI/FWS, Kenai National Wildlife Refugelocation not on record	2
CUlocation not on record	1
NARlocation not on record	1
San Nicolás de los Garza, MX	1
Mohonk Preserve, Inc.location not on record	1
Provincia di Ascoli Picenolocation not on record	1

13 institutions · 598 of 598 vouchered records shown

09Environmental DNA193 detections

Where the DNA of Aedes pullatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found193

Studies independent surveys4

Countries5

Verifiable raw sequence linked36

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 193 detections have coordinates

Open the map5 countries0

dwarfScrubshrubScrubdeciduousForestTundraForestwoodyWetlands

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C -2.10–14.2

Seasonal swing summer↔winter23.7 °C

Max temp (day)13.1 °C 1.90–21.5

Min temp (night)6.20 °C -5.60–10.1

Precipitation95.2 mm/mo 46.1–157

Air humidity60.2 % 53.1–67.7

Moisture balance5.60 mm/mo -88.3–68.9

Vapour deficit490 Pa 288–761

Wind speed3.30 m/s 1.80–5.80

Cloud cover60.1 % 19.5–63.9

CHELSA 1981–2010, ~9 km grid, at location & month of 177 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)