Aedes alboannulatus

(Macquart, 1850) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records768

Data sources5

Biological traits0

DNA specimens31

eDNA detections32

Sources5 archives

Databases and archives Aedes alboannulatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility768 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF768 records

Environmental DNA1 datasets · 1 countries32 detections

DNA & barcodingBOLD31 specimens

01Narrative

Dobrotworskyius alboannulatus is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1850 door Macquart.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes alboannulatus has left across the world's sequence archives.

At a glance

DNA specimens31

BINs1

Marker genes3

eDNA detections32

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

46Amostly conserved

49Cmostly conserved

50Tmostly conserved

181Amostly conserved

193Cmostly conserved

202Avariable

208Amostly conserved

247Tmostly conserved

400Tmostly conserved

412Amostly conserved

415Avariable

433Amostly conserved

478Avariable

508Amostly conserved

562Amostly conserved

628Amostly conserved

634Cmostly conserved

646Tmostly conserved

AACATTATATTTCATTTTTGGAATTTGATCAGGAATAGTAGGAACATCCTTAAGAATTTTAATTCGTGCTGAATTAAGACACCCTGGGAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.78%

Haplotypes6

BIN1

Most divergent pair2.0%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes rubrithoraxsame genus4.3%Aedes mariaesame genus7.1%Aedes camptorhynchussame genus7.1%Aedes guerrerosame genus7.3%Aedes dorsalissame genus7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS218S-5P

animal barcodefungal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_054319 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1large subunit ribosomal RNAsmall subunit ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type768 records

Wild obs. + sensor466

Museum / vouchered302

Range

Area of Occupancy AOO1 864 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 206≤1 km 64≤10 km 25>10 km 46

341 georeferenced · 125 without coordinates

Open the mapobservation + sensor466

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 2≤1 km 1≤10 km 12>10 km 3

18 georeferenced · 284 without coordinates

Open the institutions mapphysical evidence302

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Queensland Insect Collectionlocation not on record	267
Sydney, AU	13
DPIlocation not on record	8
Museums Victorialocation not on record	7
Australian National Fish Collectionlocation not on record	3
Tasmanian Museum & Art Gallerylocation not on record	1

6 institutions · 299 of 302 vouchered records shown · 3 without an institution code

09Environmental DNA32 detections

Where the DNA of Aedes alboannulatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 12.9–18.0

Seasonal swing summer↔winter9.30 °C

Max temp (day)18.5 °C 15.2–21.7

Min temp (night)11.7 °C 8.70–14.4

Precipitation70.1 mm/mo 50.4–129

Air humidity57.5 % 54.8–58.1

Moisture balance-56.3 mm/mo -85.5–64.0

Vapour deficit709 Pa 627–960

Wind speed4.10 m/s 2.70–6.20

Cloud cover17.3 % 14.5–22.4

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)