Acronicta hamamelis

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records279

Data sources6

Biological traits0

DNA specimens4

eDNA detections4

Sources6 archives

Databases and archives Acronicta hamamelis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility279 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF279 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

Acronicta subochrea is een vlinder uit de familie van de uilen (Noctuidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1874 door Grote.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta hamamelis has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

291Tmostly conserved

355Cvariable

388Avariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCACTAAGATTACTAATTCGAGCAGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.28%

Haplotypes3

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta lithospilasame genus4.4%Acronicta griseasame genus5.0%Acronicta tritonasame genus5.2%Acronicta superanssame genus5.5%Agriopodes fallaxsame family5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type279 records

Wild obs. + sensor183

Museum / vouchered96

Range

Area of Occupancy AOO700 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 64≤1 km 39≤10 km 12>10 km 41

156 georeferenced · 27 without coordinates

Open the mapobservation + sensor183

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 1≤1 km 13≤10 km 22>10 km 4

40 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence96

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	21
East Lansing, US	19
St. Paul, US	17
North Carolina State University Insect Museumlocation not on record	11
Philadelphia, US	7
Colorado State Universitylocation not on record	5
Georgia Museum of Natural Historylocation not on record	4
Chicago, US	3
Decorah, US	2
New Haven, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1

12 institutions · 93 of 96 vouchered records shown · 3 without an institution code

09Environmental DNA4 detections

Where the DNA of Acronicta hamamelis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 19.0–27.6

Seasonal swing summer↔winter17.7 °C

Max temp (day)28.5 °C 23.0–32.6

Min temp (night)23.2 °C 15.9–24.3

Precipitation146 mm/mo 98.5–203

Air humidity61.9 % 60.7–63.3

Moisture balance10.6 mm/mo -45.8–41.4

Vapour deficit1,226 Pa 853–1,430

Wind speed1.90 m/s 1.50–4.50

Cloud cover29.4 % 27.1–33.7

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)