Acronicta tritona

Hübner, 1818 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records576

Data sources7

Biological traits0

DNA specimens17

eDNA detections17

Sources7 archives

Databases and archives Acronicta tritona's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility576 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF576 records

Environmental DNA1 datasets · 2 countries17 detections

DNA & barcodingBOLD17 specimens

01Narrative

Acronicta tritona, the Triton dagger moth, is a moth of the family Noctuidae. The species was first described by Jacob Hübner in 1818. It is found in eastern North America, from Nova Scotia west to north-eastern Alberta, south to Florida and Texas, and west to Oregon. The wingspan is 35–40 mm. The larva feed on Helonias bullata and Vaccinium species, including Oxycoccos species and Vaccinium stamineum.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta tritona has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

eDNA detections17

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

118Tmostly conserved

202Amostly conserved

250Tmostly conserved

433Amostly conserved

499Cmostly conserved

562Gmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTCTAAGATTACTAATTCGAGCAGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.12%

Haplotypes5

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta hamamelissame genus5.2%Acronicta lithospilasame genus5.5%Agriopodes fallaxsame family5.6%Acronicta herculessame genus5.9%Acronicta valliscolasame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type576 records

Wild obs. + sensor315

Museum / vouchered261

Range

Area of Occupancy AOO1 440 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 116≤1 km 60≤10 km 44>10 km 34

254 georeferenced · 61 without coordinates

Open the mapobservation + sensor315

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 1≤1 km 56≤10 km 85>10 km 7

149 georeferenced · 112 without coordinates

Open the institutions mapphysical evidence261

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	76
East Lansing, US	52
New Haven, US	38
North Carolina State University Insect Museumlocation not on record	26
Cornell University Insect Collectionlocation not on record	17
Georgia Museum of Natural Historylocation not on record	10
University of Alberta Museums (UAM)location not on record	9
CUlocation not on record	8
Colorado State Universitylocation not on record	7
Brussels, BE	3
St. Paul, US	3
RBINS-Scientific Heritagelocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Denver, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Toronto, CA	1
Chicago, US	1

17 institutions · 256 of 261 vouchered records shown · 5 without an institution code

09Environmental DNA17 detections

Where the DNA of Acronicta tritona was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.5 °C 11.6–27.1

Seasonal swing summer↔winter18.9 °C

Max temp (day)24.3 °C 15.6–31.8

Min temp (night)14.9 °C 8.70–23.0

Precipitation119 mm/mo 97.1–238

Air humidity61.2 % 57.6–61.9

Moisture balance-0.8 mm/mo -32.1–73.2

Vapour deficit882 Pa 525–1,371

Wind speed2.30 m/s 1.90–5.30

Cloud cover38.3 % 30.7–49.8

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)