Agriopodes fallax

Herrich-Schäffer, 1854 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Agriopodes

At a glance

Occurrence records153

Data sources5

Biological traits0

DNA specimens30

eDNA detections30

Sources5 archives

Databases and archives Agriopodes fallax's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility153 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF153 records

Environmental DNA1 datasets · 2 countries30 detections

DNA & barcodingBOLD30 specimens

01Narrative

Agriopodes fallax is een vlinder uit de familie van de uilen (Noctuidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1853 door Herrich-Schäffer.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agriopodes fallax has left across the world's sequence archives.

At a glance

DNA specimens30

BINs1

Marker genes1

eDNA detections30

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

244Amostly conserved

368Gmostly conserved

433Amostly conserved

499Tvariable

532Cmostly conserved

536Tvariable

610Cmostly conserved

613Tmostly conserved

616Cvariable

622Gmostly conserved

646Cvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTACTAATTCGAGCAGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.64%

Haplotypes11

BIN1

Most divergent pair2.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta hamamelissame family5.5%Acronicta tritonasame family5.6%Acronicta lithospilasame family5.6%Acronicta mansuetasame family6.7%Acronicta valliscolasame family6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type153 records

Wild obs. + sensor2

Museum / vouchered151

Range

Area of Occupancy AOO308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 3≤1 km 26≤10 km 59>10 km 5

93 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence151

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	79
University of Alberta Museums (UAM)location not on record	29
University of Guelph, Centre for Biodiversity Genomicslocation not on record	7
St. Paul, US	7
Brussels, BE	5
OSUClocation not on record	4
Toronto, CA	4
RBINS-Scientific Heritagelocation not on record	4
Washington, US	3
Philadelphia, US	2
Georgia Museum of Natural Historylocation not on record	2
UDlocation not on record	2
San Diego, US	1
Denver, US	1
University Park, US	1

15 institutions · 151 of 151 vouchered records shown

09Environmental DNA30 detections

Where the DNA of Agriopodes fallax was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map2 countries0

Temperate mixed forestForestMixed HabitatGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 14.8–20.7

Seasonal swing summer↔winter26.1 °C

Max temp (day)23.7 °C 19.3–25.4

Min temp (night)13.9 °C 9.20–16.9

Precipitation86.4 mm/mo 82.5–111

Air humidity57.0 % 55.6–62.0

Moisture balance-58.0 mm/mo -67.2–14.9

Vapour deficit888 Pa 688–1,037

Wind speed3.40 m/s 2.40–4.70

Cloud cover41.5 % 38.2–49.1

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)