Acronicta lithospila

Grote, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records572

Data sources7

Biological traits0

DNA specimens9

eDNA detections10

Sources7 archives

Databases and archives Acronicta lithospila's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility572 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF572 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD9 specimens

01Narrative

Acronicta lithospila, the streaked dagger moth, is a moth of the family Noctuidae described by Augustus Radcliffe Grote in 1874. It is found in Canada (Nova Scotia, New Brunswick, Quebec, and Ontario) and the United States (including Georgia, Maryland and Oklahoma). Larva The wingspan is about 35 mm. Adults are on wing from June to August depending on the location. The larvae feed on hickory and oak.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta lithospila has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections10

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

26Tmostly conserved

214Gmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTACTAATTCGAGCAGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.07%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta hamamelissame genus4.4%Acronicta valliscolasame genus4.9%Acronicta tritonasame genus5.5%Acronicta griseasame genus5.6%Agriopodes fallaxsame family5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type572 records

Wild obs. + sensor370

Museum / vouchered202

Range

Area of Occupancy AOO1 276 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 174≤1 km 86≤10 km 22>10 km 19

301 georeferenced · 69 without coordinates

Open the mapobservation + sensor370

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 1≤1 km 26≤10 km 120>10 km 5

152 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence202

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	60
East Lansing, US	45
New Haven, US	29
CUlocation not on record	12
Philadelphia, US	8
North Carolina State University Insect Museumlocation not on record	8
Colorado State Universitylocation not on record	6
ASUlocation not on record	6
Georgia Museum of Natural Historylocation not on record	5
St. Paul, US	4
Cornell University Insect Collectionlocation not on record	4
Natural History Museum of Utahlocation not on record	2
OSUClocation not on record	2
UDlocation not on record	2
King Saud Universitylocation not on record	1
University of Alberta Museums (UAM)location not on record	1
Chicago, US	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1

18 institutions · 197 of 202 vouchered records shown · 5 without an institution code

09Environmental DNA10 detections

Where the DNA of Acronicta lithospila was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.0 °C 15.1–25.0

Seasonal swing summer↔winter20.7 °C

Max temp (day)25.0 °C 20.8–29.1

Min temp (night)15.5 °C 9.20–20.8

Precipitation108 mm/mo 90.7–120

Air humidity59.0 % 53.9–62.9

Moisture balance-23.8 mm/mo -61.7–-13.7

Vapour deficit886 Pa 746–1,342

Wind speed2.80 m/s 1.80–3.60

Cloud cover35.6 % 27.5–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)