Acronicta grisea

Walker, 1856 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records1 299

Data sources6

Biological traits0

DNA specimens62

eDNA detections62

Sources6 archives

Databases and archives Acronicta grisea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 299 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI62 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics62 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 299 records

Environmental DNA1 datasets · 2 countries62 detections

DNA & barcodingBOLD62 specimens

01Narrative

Acronicta grisea is een vlinder uit de familie van de uilen (Noctuidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1856 door Walker.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding62 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta grisea has left across the world's sequence archives.

At a glance

DNA specimens62

BINs1

Marker genes1

eDNA detections62

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus60 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

619Amostly conserved

AACATTATATTTTATTTTCGGTATTTGAGCAGGAATAGTAGGTACTTCACTAAGATTGCTAATTCGAGCAGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.12%

Haplotypes14

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta hamamelissame genus5.0%Acronicta lithospilasame genus5.6%Acronicta spinigerasame genus6.5%Acronicta tritonasame genus6.5%Acronicta valliscolasame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 299 records

Wild obs. + sensor617

Museum / vouchered682

Range

Area of Occupancy AOO2 448 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 404≤1 km 60≤10 km 36>10 km 23

523 georeferenced · 94 without coordinates

Open the mapobservation + sensor617

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 86≤1 km 109≤10 km 114>10 km 8

317 georeferenced · 365 without coordinates

Open the institutions mapphysical evidence682

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	169
Colorado State Universitylocation not on record	134
East Lansing, US	99
New Haven, US	44
Oregon State Arthropod Collectionlocation not on record	32
St. Paul, US	29
Royal Saskatchewan Museumlocation not on record	28
Denver, US	20
University of Guelph, Centre for Biodiversity Genomicslocation not on record	19
Brussels, BE	15
RBINS-Scientific Heritagelocation not on record	11
Vernal, US	9
Toronto, CA	5
Cambridge, US	3
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
San Francisco, US	2
ASUlocation not on record	2
WWUlocation not on record	1
Chicago, US	1

19 institutions · 626 of 682 vouchered records shown · 56 without an institution code

09Environmental DNA62 detections

Where the DNA of Acronicta grisea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found62

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 62 detections have coordinates

Open the map2 countries0

GrasslandMixed Habitatmixed forestForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 13.6–19.4

Seasonal swing summer↔winter26.4 °C

Max temp (day)20.6 °C 18.1–23.6

Min temp (night)11.4 °C 8.20–16.4

Precipitation86.9 mm/mo 44.1–111

Air humidity57.6 % 52.8–62.7

Moisture balance-53.5 mm/mo -87.6–-14.3

Vapour deficit743 Pa 635–903

Wind speed2.80 m/s 1.70–3.90

Cloud cover43.7 % 33.4–51.3

CHELSA 1981–2010, ~9 km grid, at location & month of 55 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acronicta grisea

At a glance

Sources6 archives

At a glance

Record type1 299 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 299 records