Acronicta spinigera

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records200

Data sources7

Biological traits0

DNA specimens19

eDNA detections19

Sources7 archives

Databases and archives Acronicta spinigera's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility200 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF200 records

Environmental DNA1 datasets · 2 countries19 detections

DNA & barcodingBOLD19 specimens

01Narrative

Acronicta spinigera, the nondescript dagger moth, is a species of moth of the family Noctuidae. It is found in southeastern Canada (Quebec and Ontario) and the eastern United States. The wingspan is about 40 mm. Adults are in flight from May to July in the northern part of the range and from April to September in the southern part.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta spinigera has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes1

eDNA detections19

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

20Gmostly conserved

22Amostly conserved

31Amostly conserved

106Cmostly conserved

160Amostly conserved

263Cmostly conserved

364Cvariable

595Tmostly conserved

628Avariable

637Amostly conserved

658Tvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCATTAAGATTACTAATTCGAGCAGAATTAGGAACCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.50%

Haplotypes11

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta laetificasame genus2.3%Acronicta radcliffeisame genus2.7%Acronicta quadratasame genus3.2%Acronicta interruptasame genus3.3%Acronicta hastasame genus3.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type200 records

Wild obs. + sensor46

Museum / vouchered154

Range

Area of Occupancy AOO480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 21≤1 km 3≤10 km 11>10 km 5

40 georeferenced · 6 without coordinates

Open the mapobservation + sensor46

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 1≤1 km 14≤10 km 17>10 km 7

39 georeferenced · 115 without coordinates

Open the institutions mapphysical evidence154

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cleveland Museum of Natural History, OH (CLEV)location not on record	30
St. Paul, US	17
Mississippi State, US	16
East Lansing, US	13
University of Alberta Museums (UAM)location not on record	12
New Haven, US	10
Denver, US	7
Decorah, US	7
Royal Saskatchewan Museumlocation not on record	6
OSUClocation not on record	5
Philadelphia, US	4
Colorado State Universitylocation not on record	2
Chicago, US	2
Toronto, CA	2
CUlocation not on record	2
Georgia Museum of Natural Historylocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1

18 institutions · 138 of 154 vouchered records shown · 16 without an institution code

09Environmental DNA19 detections

Where the DNA of Acronicta spinigera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map2 countries0

Temperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 13.1–22.1

Seasonal swing summer↔winter20.6 °C

Max temp (day)22.1 °C 18.4–26.9

Min temp (night)13.2 °C 7.50–17.6

Precipitation116 mm/mo 85.9–132

Air humidity58.9 % 56.5–63.4

Moisture balance-22.1 mm/mo -57.3–5.10

Vapour deficit797 Pa 671–1,057

Wind speed2.70 m/s 1.80–3.40

Cloud cover39.1 % 28.2–43.5

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)