Acronicta laetifica

Smith, 1897 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records382

Data sources7

Biological traits0

DNA specimens25

eDNA detections25

Sources7 archives

Databases and archives Acronicta laetifica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility382 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF382 records

Environmental DNA1 datasets · 2 countries25 detections

DNA & barcodingBOLD25 specimens

01Narrative

Acronicta laetifica, the pleasant dagger moth, is a moth of the family Noctuidae. The species was first described by John Bernhardt Smith in 1897. It is found in North America from Nova Scotia to Florida, west to Texas, north to Manitoba. The wingspan is 37–43 mm. Adults are on wing from May to July in Ohio and from April to October in the south. There are two or more generations in the south and one in the north. The larvae feed on Carya species (hickory).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta laetifica has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes1

eDNA detections25

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

76Gmostly conserved

106Cvariable

282Cvariable

313Tvariable

364Cmostly conserved

428Cvariable

433Amostly conserved

557Tvariable

562Tvariable

634Tvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCATTAAGATTACTAATTCGAGCAGAATTGGGAACCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.68%

Haplotypes9

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta spinigerasame genus2.3%Acronicta radcliffeisame genus3.8%Acronicta quadratasame genus4.0%Acronicta interruptasame genus4.4%Acronicta hastasame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type382 records

Wild obs. + sensor125

Museum / vouchered257

Range

Area of Occupancy AOO892 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 58≤1 km 20≤10 km 15>10 km 9

102 georeferenced · 23 without coordinates

Open the mapobservation + sensor125

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 12≤1 km 31≤10 km 98>10 km 1

142 georeferenced · 115 without coordinates

Open the institutions mapphysical evidence257

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	81
University of Alberta Museums (UAM)location not on record	31
New Haven, US	30
East Lansing, US	25
ASUlocation not on record	17
Cleveland Museum of Natural History, OH (CLEV)location not on record	16
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	8
Colorado State Universitylocation not on record	7
CUlocation not on record	4
Toronto, CA	4
SOVTlocation not on record	3
OSUClocation not on record	2
Vernal, US	2
Champaign, US	2
San Francisco, US	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Decorah, US	1
Washington, US	1
Chicago, US	1
Georgia Museum of Natural Historylocation not on record	1

20 institutions · 238 of 257 vouchered records shown · 19 without an institution code

09Environmental DNA25 detections

Where the DNA of Acronicta laetifica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map2 countries0

Temperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 14.4–22.7

Seasonal swing summer↔winter21.1 °C

Max temp (day)25.2 °C 17.6–27.5

Min temp (night)16.0 °C 12.2–18.2

Precipitation115 mm/mo 94.4–135

Air humidity58.5 % 57.6–61.2

Moisture balance-28.3 mm/mo -60.7–13.4

Vapour deficit981 Pa 681–1,071

Wind speed2.40 m/s 1.30–3.50

Cloud cover39.7 % 28.1–45.2

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)