Acronicta interrupta

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records1 055

Data sources7

Biological traits0

DNA specimens28

eDNA detections28

Sources7 archives

Databases and archives Acronicta interrupta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 055 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 055 records

Environmental DNA1 datasets · 2 countries28 detections

DNA & barcodingBOLD28 specimens

01Narrative

Acronicta interrupta, the interrupted dagger moth, is a moth of the family Noctuidae. The species was first described by Achille Guenée in 1852. It is found across southern Canada south of the boreal forest, from New Brunswick west to eastern Alberta, south to Georgia, Nebraska and Arizona. The wingspan is 35–42 mm. Adults are on wing from April to August or September depending on the location. There are two or more generations per year in the south and one in the north. The larvae feed on apple, apricot, birch, cherry, crabapple, elm, hawthorn, hop-hornbeam, mountain-ash, oak, plum and willow.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta interrupta has left across the world's sequence archives.

At a glance

DNA specimens28

BINs1

Marker genes1

eDNA detections28

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

283Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGTACTTCATTAAGATTATTAATTCGAGCAGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.11%

Haplotypes4

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta spinigerasame genus3.3%Acronicta hastasame genus3.5%Acronicta radcliffeisame genus4.1%Acronicta quadratasame genus4.1%Acronicta laetificasame genus4.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 055 records

Wild obs. + sensor594

Museum / vouchered461

Range

Area of Occupancy AOO2 752 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 358≤1 km 61≤10 km 33>10 km 54

506 georeferenced · 88 without coordinates

Open the mapobservation + sensor594

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 16≤1 km 90≤10 km 174>10 km 36

316 georeferenced · 145 without coordinates

Open the institutions mapphysical evidence461

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	144
New Haven, US	83
Colorado State Universitylocation not on record	45
St. Paul, US	40
Mississippi State, US	34
University of Alberta Museums (UAM)location not on record	18
Cleveland Museum of Natural History, OH (CLEV)location not on record	11
Cornell University Insect Collectionlocation not on record	8
North Carolina State University Insect Museumlocation not on record	8
Philadelphia, US	7
King Saud Universitylocation not on record	7
OSUClocation not on record	7
CUlocation not on record	6
Royal Saskatchewan Museumlocation not on record	6
UDlocation not on record	5
Decorah, US	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
SOVTlocation not on record	2
Denver, US	1
Natural History Museum of Utahlocation not on record	1
Toronto, CA	1

21 institutions · 441 of 461 vouchered records shown · 20 without an institution code

09Environmental DNA28 detections

Where the DNA of Acronicta interrupta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map2 countries0

Temperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.4 °C 14.0–24.3

Seasonal swing summer↔winter25.1 °C

Max temp (day)23.6 °C 19.3–29.0

Min temp (night)16.4 °C 9.50–19.7

Precipitation92.6 mm/mo 82.7–154

Air humidity59.6 % 56.4–64.9

Moisture balance-42.2 mm/mo -62.8–26.4

Vapour deficit851 Pa 667–1,251

Wind speed2.90 m/s 1.60–4.00

Cloud cover38.2 % 27.5–51.3

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acronicta interrupta

At a glance

Sources7 archives

At a glance

Record type1 055 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 055 records