Acronicta hasta

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records2 204

Data sources7

Biological traits0

DNA specimens79

eDNA detections79

Sources7 archives

Databases and archives Acronicta hasta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 204 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI79 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics79 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 204 records

Environmental DNA1 datasets · 2 countries79 detections

DNA & barcodingBOLD79 specimens

01Narrative

Acronicta hasta, the forked dagger moth, speared dagger moth, cherry dagger moth or dart dagger moth, is a moth of the family Noctuidae. The species was first described by Achille Guenée in 1852. It is found in North America in the eastern deciduous woodlands, ranging west across southern Saskatchewan and Alberta into central southern British Columbia, south to Tennessee, Wisconsin and Kansas. Acronicta furcifera was considered a separate species until 1998, but is now considered a synonym. The wingspan is 35–45 mm. Adults are on wing from April to September depending on the location. There are two or more generations per year in the south and one or two in the north. The larvae feed on cherry, oak and plum.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding79 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta hasta has left across the world's sequence archives.

At a glance

DNA specimens79

BINs1

Marker genes1

eDNA detections79

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus77 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCATTAAGATTACTAATTCGAGCAGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.14%

Haplotypes15

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta radcliffeisame genus3.3%Acronicta interruptasame genus3.5%Acronicta spinigerasame genus3.6%Acronicta quadratasame genus3.8%Acronicta betulaesame genus4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 204 records

Wild obs. + sensor1 120

Museum / vouchered1 084

Range

Area of Occupancy AOO4 640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 624≤1 km 163≤10 km 69>10 km 81

937 georeferenced · 183 without coordinates

Open the mapobservation + sensor1 120

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 38≤1 km 262≤10 km 419>10 km 29

748 georeferenced · 336 without coordinates

Open the institutions mapphysical evidence1 084

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	323
East Lansing, US	218
Mississippi State, US	135
Cleveland Museum of Natural History, OH (CLEV)location not on record	45
University of Alberta Museums (UAM)location not on record	44
ASUlocation not on record	43
Colorado State Universitylocation not on record	40
CUlocation not on record	33
Royal Saskatchewan Museumlocation not on record	23
University of Guelph, Centre for Biodiversity Genomicslocation not on record	21
Cornell University Insect Collectionlocation not on record	17
OSUClocation not on record	15
St. Paul, US	12
Georgia Museum of Natural Historylocation not on record	11
Toronto, CA	8
UDlocation not on record	8
Vernal, US	7
Cambridge, US	7
Brussels, BE	5
RBINS-Scientific Heritagelocation not on record	4
Decorah, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
University of Guelphlocation not on record	1
Washington, US	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Philadelphia, US	1
SOVTlocation not on record	1
Champaign, US	1

28 institutions · 1 028 of 1 084 vouchered records shown · 56 without an institution code

09Environmental DNA79 detections

Where the DNA of Acronicta hasta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found79

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 79 detections have coordinates

Open the map2 countries0

GrasslandForestUrbanTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 11.6–22.5

Seasonal swing summer↔winter26.1 °C

Max temp (day)22.1 °C 16.4–27.1

Min temp (night)13.2 °C 5.80–19.0

Precipitation93.8 mm/mo 75.0–134

Air humidity58.0 % 54.8–62.2

Moisture balance-38.6 mm/mo -61.4–5.30

Vapour deficit775 Pa 578–1,102

Wind speed3.30 m/s 2.20–4.00

Cloud cover40.6 % 31.7–47.9

CHELSA 1981–2010, ~9 km grid, at location & month of 70 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acronicta hasta

At a glance

Sources7 archives

At a glance

Record type2 204 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 204 records