Acronicta hercules

Felder, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records189

Data sources6

Biological traits0

DNA specimens17

eDNA detections21

Sources6 archives

Databases and archives Acronicta hercules's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility189 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF189 records

Environmental DNA1 datasets · 3 countries21 detections

DNA & barcodingBOLD17 specimens

01Narrative

Acronicta hercules is a moth of the family Noctuidae. It is found in the Korean Peninsula, China, Japan, the Russian Far East (Primorye, southern Khabarovsk, southern Amur region), Taiwan and Sri Lanka.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta hercules has left across the world's sequence archives.

At a glance

DNA specimens17

BINs3

Marker genes1

eDNA detections21

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 83% of positions are identical in every specimen.

Where individuals differ — all 112 variable positions, in barcode order

4Tmostly conserved

5Tmostly conserved

7Tmostly conserved

8Amostly conserved

9Tvariable

10Tmostly conserved

13Amostly conserved

14Tmostly conserved

19Gmostly conserved

21Tmostly conserved

22Amostly conserved

23Tmostly conserved

26Gmostly conserved

27Amostly conserved

28Gmostly conserved

29Cmostly conserved

30Avariable

31Gmostly conserved

33Amostly conserved

37Gvariable

39Avariable

42Avariable

45Tvariable

48Tmostly conserved

57Amostly conserved

84Tmostly conserved

123Tmostly conserved

126Amostly conserved

132Tmostly conserved

162Amostly conserved

180Amostly conserved

192Tmostly conserved

196Cmostly conserved

198Tmostly conserved

199Gmostly conserved

201Avariable

204Tvariable

205Tmostly conserved

219Avariable

222Avariable

225Tmostly conserved

237Amostly conserved

255Tmostly conserved

276Tmostly conserved

277Tmostly conserved

279Amostly conserved

282Cvariable

283Cvariable

285Tvariable

297Amostly conserved

303Tmostly conserved

312Tmostly conserved

336Cvariable

339Tmostly conserved

342Cmostly conserved

345Amostly conserved

357Tmostly conserved

360Tmostly conserved

363Tmostly conserved

367Gmostly conserved

369Amostly conserved

372Tvariable

378Tmostly conserved

384Tmostly conserved

385Tvariable

387Amostly conserved

396Tmostly conserved

399Cvariable

400Cvariable

402Tvariable

414Tvariable

420Amostly conserved

423Amostly conserved

427Tvariable

435Avariable

450Amostly conserved

477Cmostly conserved

483Amostly conserved

498Tmostly conserved

513Amostly conserved

516Tmostly conserved

519Tvariable

522Tmostly conserved

525Tmostly conserved

528Amostly conserved

531Cmostly conserved

535Tmostly conserved

538Tmostly conserved

540Amostly conserved

541Cvariable

543Amostly conserved

546Tvariable

547Tmostly conserved

552Tmostly conserved

555Tmostly conserved

561Gvariable

570Tmostly conserved

573Avariable

577Cmostly conserved

579Tmostly conserved

585Tvariable

603Tvariable

606Tvariable

609Tmostly conserved

615Cvariable

618Amostly conserved

621Tmostly conserved

624Amostly conserved

627Amostly conserved

630Amostly conserved

640Cmostly conserved

642Tmostly conserved

ACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTACTAATTCGAGCAGAATTAGGAACCCCTGGATCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.5%

Haplotypes4

BINs3

Most divergent pair9.4%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta catocaloidasame genus4.8%Resapamea hedenisame family5.0%Acronicta modicasame genus5.6%Acronicta haesitatasame genus5.8%Acronicta ovatasame genus5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type189 records

Wild obs. + sensor102

Museum / vouchered87

Range

Area of Occupancy AOO496 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 15≤1 km 5≤10 km 1>10 km 2

23 georeferenced · 79 without coordinates

Open the mapobservation + sensor102

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 6≤1 km 1

7 georeferenced · 80 without coordinates

Open the institutions mapphysical evidence87

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
tesrilocation not on record	56
Hiwa Museum of Natural Historylocation not on record	6
JP	6
Philadelphia, US	3
Taiwan Forestry Research Institutelocation not on record	3
Kawasaki Shi Tama Ku, JP	3
FACTlocation not on record	2
Chiba, JP	2
HUNMlocation not on record	1
Tartu, EE	1
NSMKlocation not on record	1
Shiojiri City Museum of Natural Historylocation not on record	1
RCMlocation not on record	1
Toyota city nature sanctuarylocation not on record	1

14 institutions · 87 of 87 vouchered records shown

09Environmental DNA21 detections

Where the DNA of Acronicta hercules was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.8 °C 15.7–24.3

Seasonal swing summer↔winter9.90 °C

Max temp (day)24.5 °C 18.7–26.8

Min temp (night)16.5 °C 11.5–20.5

Precipitation316 mm/mo 201–635

Air humidity66.9 % 65.1–70.0

Moisture balance191 mm/mo 91.6–495

Vapour deficit874 Pa 538–1,007

Wind speed1.50 m/s 1.00–2.90

Cloud cover48.6 % 45.0–60.4

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)