Acronicta ovata

Grote, 1873 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records759

Data sources6

Biological traits0

DNA specimens30

eDNA detections0

Sources6 archives

Databases and archives Acronicta ovata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility759 records↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF759 records

DNA & barcodingBOLD30 specimens

01Narrative

Acronicta ovata, the ovate dagger moth, is a moth of the family Noctuidae. It is found from Nova Scotia to North Carolina, west to Texas, north to Manitoba. The wingspan is 28–35 mm. Adults are on wing from June to September depending on the location. There are two or more generations per year. The larvae feed on the leaves of beech, birch, chestnut and oak.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta ovata has left across the world's sequence archives.

At a glance

DNA specimens30

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

160Amostly conserved

262Amostly conserved

355Tmostly conserved

400Tmostly conserved

412Amostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCTTTAAGATTACTAATTCGAGCAGAATTAGGAACCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.23%

Haplotypes8

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta tristissame genus1.5%Acronicta modicasame genus2.0%Acronicta exilissame genus2.1%Acronicta incretasame genus2.6%Acronicta marmoratasame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type759 records

Wild obs. + sensor386

Museum / vouchered373

Range

Area of Occupancy AOO1 492 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 205≤1 km 56≤10 km 25>10 km 18

304 georeferenced · 82 without coordinates

Open the mapobservation + sensor386

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 26≤1 km 109≤10 km 146>10 km 18

299 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence373

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	117
New Haven, US	95
Mississippi State, US	26
Colorado State Universitylocation not on record	25
ASUlocation not on record	24
Cleveland Museum of Natural History, OH (CLEV)location not on record	17
St. Paul, US	10
CUlocation not on record	8
Cambridge, US	5
OSUClocation not on record	5
Decorah, US	5
Washington, US	4
UDlocation not on record	4
Georgia Museum of Natural Historylocation not on record	3
Toronto, CA	3
Natural History Museum of Utahlocation not on record	1
San Francisco, US	1
Chicago, US	1
SOVTlocation not on record	1

19 institutions · 355 of 373 vouchered records shown · 18 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)