Acronicta marmorata

Smith, 1897 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records582

Data sources7

Biological traits0

DNA specimens12

eDNA detections11

Sources7 archives

Databases and archives Acronicta marmorata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility582 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF582 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD12 specimens

01Narrative

Acronicta marmorata, the marble dagger moth, is a moth of the family Noctuidae. It is widespread in the Pacific West of North America, including British Columbia, Oregon and Washington. The wingspan is about 43 mm. Adults are on wing from July to August depending on the location. The larvae feed on oak species, including white oak.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta marmorata has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

313Tmostly conserved

418Cvariable

601Cvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCCCTAAGATTACTAATTCGAGCAGAATTAGGAACCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.19%

Haplotypes3

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta afflictasame genus3.6%Acronicta ovatasame genus5.0%Acronicta modicasame genus5.2%Acronicta haesitatasame genus5.3%Acronicta brumosasame genus5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type582 records

Wild obs. + sensor324

Museum / vouchered258

Range

Area of Occupancy AOO828 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 130≤1 km 36≤10 km 73>10 km 7

246 georeferenced · 78 without coordinates

Open the mapobservation + sensor324

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 14≤1 km 26≤10 km 40>10 km 12

92 georeferenced · 166 without coordinates

Open the institutions mapphysical evidence258

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oregon State Arthropod Collectionlocation not on record	86
Colorado State Universitylocation not on record	39
University of Alberta Museums (UAM)location not on record	32
East Lansing, US	18
New Haven, US	16
University of California, Davislocation not on record	13
San Diego, US	11
Helsinki, FI	11
ASUlocation not on record	7
San Francisco, US	5
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
National Institute of Biological Resourceslocation not on record	3
US	2
Chicago, US	1
WWUlocation not on record	1
Essig Museum of Entomologylocation not on record	1

16 institutions · 251 of 258 vouchered records shown · 7 without an institution code

09Environmental DNA11 detections

Where the DNA of Acronicta marmorata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 12.6–23.7

Seasonal swing summer↔winter13.3 °C

Max temp (day)23.1 °C 15.0–31.8

Min temp (night)10.7 °C 7.80–16.5

Precipitation10.5 mm/mo 0.7–64.6

Air humidity56.6 % 47.6–61.0

Moisture balance-139 mm/mo -185–-32.9

Vapour deficit753 Pa 580–1,438

Wind speed2.70 m/s 1.40–4.70

Cloud cover24.9 % 11.5–42.7

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)