Acronicta afflicta

Grote, 1864 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records1 810

Data sources7

Biological traits0

DNA specimens39

eDNA detections43

Sources7 archives

Databases and archives Acronicta afflicta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 810 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 810 records

Environmental DNA1 datasets · 3 countries43 detections

DNA & barcodingBOLD39 specimens

01Narrative

Acronicta afflicta, the afflicted dagger moth, is a moth of the family Noctuidae. It is found in Canada (Nova Scotia, Quebec and Ontario), the United States (including Alabama, North Carolina, Oklahoma, Georgia, Maryland, New York and Ohio) as well as northern Mexico. Illustration Larva The wingspan is about 36 mm. Adults are on wing from May to September depending on the location. The larvae feed on various Quercus species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta afflicta has left across the world's sequence archives.

At a glance

DNA specimens39

BINs1

Marker genes1

eDNA detections43

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCCCTAAGATTACTAATTCGAGCAGAATTAGGAACCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.10%

Haplotypes5

BIN1

Most divergent pair0.61%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta marmoratasame genus3.6%Acronicta brumosasame genus4.4%Acronicta haesitatasame genus5.2%Acronicta modicasame genus5.3%Acronicta tristissame genus5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 810 records

Wild obs. + sensor1 255

Museum / vouchered555

Range

Area of Occupancy AOO4 332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 678≤1 km 168≤10 km 96>10 km 90

1 032 georeferenced · 223 without coordinates

Open the mapobservation + sensor1 255

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 5≤1 km 57≤10 km 231>10 km 24

317 georeferenced · 238 without coordinates

Open the institutions mapphysical evidence555

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	200
East Lansing, US	81
New Haven, US	79
CUlocation not on record	57
Georgia Museum of Natural Historylocation not on record	21
Cornell University Insect Collectionlocation not on record	20
University of Alberta Museums (UAM)location not on record	14
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	12
North Carolina State University Insect Museumlocation not on record	10
Colorado State Universitylocation not on record	9
Cleveland Museum of Natural History, OH (CLEV)location not on record	7
King Saud Universitylocation not on record	5
Denver, US	4
Chicago, US	4
Natural History Museum of Utahlocation not on record	3
St. Paul, US	3
OSUClocation not on record	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
UDlocation not on record	2
San Francisco, US	1
Washington, US	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Toronto, CA	1
US	1

24 institutions · 541 of 555 vouchered records shown · 14 without an institution code

09Environmental DNA43 detections

Where the DNA of Acronicta afflicta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found43

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 43 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.6 °C 15.0–26.1

Seasonal swing summer↔winter20.8 °C

Max temp (day)24.8 °C 20.8–31.4

Min temp (night)15.5 °C 9.20–22.7

Precipitation109 mm/mo 89.0–182

Air humidity59.1 % 55.1–63.2

Moisture balance-20.6 mm/mo -65.9–35.4

Vapour deficit928 Pa 717–1,264

Wind speed3.10 m/s 1.90–4.30

Cloud cover36.8 % 27.4–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acronicta afflicta

At a glance

Sources7 archives

At a glance

Record type1 810 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 810 records