Acronicta tristis

Smith, 1911 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records220

Data sources7

Biological traits0

DNA specimens52

eDNA detections52

Sources7 archives

Databases and archives Acronicta tristis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility220 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI52 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics52 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF220 records

Environmental DNA1 datasets · 2 countries52 detections

DNA & barcodingBOLD52 specimens

01Narrative

Acronicta tristis is a moth of the family Noctuidae. It is found from Ontario, Quebec and New Brunswick, south to Maryland, Pennsylvania and Ohio. The wingspan is about 34 mm. Adults are on wing from June to July.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding52 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta tristis has left across the world's sequence archives.

At a glance

DNA specimens52

BINs1

Marker genes1

eDNA detections52

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus52 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

160Amostly conserved

616Cmostly conserved

625Amostly conserved

658Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCTTTAAGATTACTAATTCGAGCAGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.11%

Haplotypes6

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta ovatasame genus1.5%Acronicta exilissame genus1.8%Acronicta haesitatasame genus2.0%Acronicta incretasame genus2.0%Acronicta modicasame genus2.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type220 records

Wild obs. + sensor104

Museum / vouchered116

Range

Area of Occupancy AOO424 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 66≤1 km 10≤10 km 2>10 km 6

84 georeferenced · 20 without coordinates

Open the mapobservation + sensor104

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤1 km 3≤10 km 11

14 georeferenced · 102 without coordinates

Open the institutions mapphysical evidence116

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	29
University of Guelph, Centre for Biodiversity Genomicslocation not on record	13
Mississippi State, US	11
East Lansing, US	8
Colorado State Universitylocation not on record	3
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
Decorah, US	2
Saint John, CA	2
St. Paul, US	2
Philadelphia, US	1
OSUClocation not on record	1
Washington, US	1
UDlocation not on record	1
SOVTlocation not on record	1

14 institutions · 78 of 116 vouchered records shown · 38 without an institution code

09Environmental DNA52 detections

Where the DNA of Acronicta tristis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found52

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 52 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.4 °C 18.0–23.7

Seasonal swing summer↔winter26.4 °C

Max temp (day)23.6 °C 23.1–29.0

Min temp (night)16.4 °C 13.1–18.7

Precipitation89.3 mm/mo 82.0–125

Air humidity62.2 % 58.4–62.7

Moisture balance-47.8 mm/mo -66.4–-12.6

Vapour deficit838 Pa 808–1,194

Wind speed2.80 m/s 2.20–3.90

Cloud cover47.5 % 28.7–51.3

CHELSA 1981–2010, ~9 km grid, at location & month of 48 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)