Acronicta increta

Morrison, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records1 188

Data sources6

Biological traits0

DNA specimens145

eDNA detections171

Sources6 archives

Databases and archives Acronicta increta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 188 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI171 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics145 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 188 records

Environmental DNA1 datasets · 2 countries171 detections

DNA & barcodingBOLD145 specimens

01Narrative

Acronicta increta is een nachtvlinder uit de familie van de Noctuidae, de uilen. De vlinder hoort tot een moeilijke groep, en in de naamgeving van deze soort is het een en ander veranderd. Door een aantal auteurs wordt Acronicta inclara als een synoniem gezien. De vlinder komt voor van in het zuiden van Canada en in de Verenigde Staten tot in Florida en Texas. Waardplanten van A. increta zijn eik, kastanje en beuk.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding145 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta increta has left across the world's sequence archives.

At a glance

DNA specimens145

BINs1

Marker genes1

eDNA detections171

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus142 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

172Cmostly conserved

235Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCTTTAAGATTACTAATTCGAGCAGAATTAGGAACCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes17

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta tristissame genus2.0%Acronicta ovatasame genus2.6%Acronicta modicasame genus2.9%Acronicta haesitatasame genus3.0%Acronicta marmoratasame genus5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 188 records

Wild obs. + sensor623

Museum / vouchered565

Range

Area of Occupancy AOO2 104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 350≤1 km 69≤10 km 37>10 km 28

484 georeferenced · 139 without coordinates

Open the mapobservation + sensor623

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 16≤1 km 62≤10 km 144>10 km 11

233 georeferenced · 332 without coordinates

Open the institutions mapphysical evidence565

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	322
East Lansing, US	80
North Carolina State University Insect Museumlocation not on record	22
University of Alberta Museums (UAM)location not on record	18
Georgia Museum of Natural Historylocation not on record	15
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
Decorah, US	5
UDlocation not on record	5
Colorado State Universitylocation not on record	3
Toronto, CA	3
OSUClocation not on record	2
Washington, US	2
Royal Saskatchewan Museumlocation not on record	2
University of Guelphlocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Philadelphia, US	1
San Francisco, US	1
Natural History Museum of Utahlocation not on record	1
Brussels, BE	1
SOVTlocation not on record	1
RBINS-Scientific Heritagelocation not on record	1
Champaign, US	1

22 institutions · 494 of 565 vouchered records shown · 71 without an institution code

09Environmental DNA171 detections

Where the DNA of Acronicta increta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found171

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 171 detections have coordinates

Open the map2 countries0

Temperate mixed forestForest1. Forest & Woodland|1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.6 °C 15.1–25.3

Seasonal swing summer↔winter21.6 °C

Max temp (day)24.6 °C 20.2–30.2

Min temp (night)15.2 °C 9.80–21.0

Precipitation111 mm/mo 81.0–178

Air humidity59.3 % 54.8–64.1

Moisture balance-28.3 mm/mo -70.7–34.5

Vapour deficit924 Pa 694–1,290

Wind speed3.00 m/s 1.80–4.60

Cloud cover36.9 % 27.0–45.4

CHELSA 1981–2010, ~9 km grid, at location & month of 152 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acronicta increta

At a glance

Sources6 archives

At a glance

Record type1 188 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 188 records