Acronicta superans

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records1 721

Data sources7

Biological traits0

DNA specimens29

eDNA detections29

Sources7 archives

Databases and archives Acronicta superans's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 721 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 721 records

Environmental DNA1 datasets · 2 countries29 detections

DNA & barcodingBOLD29 specimens

01Narrative

Acronicta superans, the splendid dagger moth, is a moth of the family Noctuidae. The species was first described by Achille Guenée in 1852. Larva The wingspan is 40–45 mm. Adults are on wing from May to August depending on the location.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta superans has left across the world's sequence archives.

At a glance

DNA specimens29

BINs1

Marker genes1

eDNA detections29

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

202Amostly conserved

367Tmostly conserved

542Cmostly conserved

AACATTGTATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCATTAAGATTACTAATTCGAGCAGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.14%

Haplotypes6

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta hamamelissame genus5.5%Acronicta spinigerasame genus5.8%Acronicta connectasame genus5.8%Acronicta betulaesame genus5.9%Acronicta thoracicasame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 721 records

Wild obs. + sensor1 442

Museum / vouchered279

Range

Area of Occupancy AOO4 044 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 891≤1 km 195≤10 km 68>10 km 84

1 238 georeferenced · 204 without coordinates

Open the mapobservation + sensor1 442

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 9≤1 km 74≤10 km 78>10 km 10

171 georeferenced · 108 without coordinates

Open the institutions mapphysical evidence279

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	83
University of Alberta Museums (UAM)location not on record	55
New Haven, US	45
Colorado State Universitylocation not on record	18
University of Guelph, Centre for Biodiversity Genomicslocation not on record	9
Cambridge, US	7
Toronto, CA	6
St. Paul, US	6
Brussels, BE	6
Cleveland Museum of Natural History, OH (CLEV)location not on record	4
OSUClocation not on record	3
ASUlocation not on record	2
RBINS-Scientific Heritagelocation not on record	2
SOVTlocation not on record	2
Denver, US	1
University of Guelphlocation not on record	1
Chicago, US	1
Royal Saskatchewan Museumlocation not on record	1

18 institutions · 252 of 279 vouchered records shown · 27 without an institution code

09Environmental DNA29 detections

Where the DNA of Acronicta superans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map2 countries0

1. Forest & WoodlandForestGrasslandTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 12.2–21.4

Seasonal swing summer↔winter26.2 °C

Max temp (day)22.6 °C 16.4–26.5

Min temp (night)13.4 °C 8.50–17.7

Precipitation95.1 mm/mo 82.4–137

Air humidity60.4 % 56.1–63.6

Moisture balance-38.9 mm/mo -59.1–10.6

Vapour deficit791 Pa 595–1,040

Wind speed3.30 m/s 1.90–4.00

Cloud cover41.8 % 28.2–51.3

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acronicta superans

At a glance

Sources7 archives

At a glance

Record type1 721 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 721 records