Acleris variana

(Fernald, 1886) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records1 235

Data sources9

Biological traits0

DNA specimens263

eDNA detections307

Sources9 archives

Databases and archives Acleris variana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 235 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI307 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics263 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 235 records

Environmental DNA1 datasets · 2 countries307 detections

DNA & barcodingBOLD263 specimens

Genome at a glanceGoaT2n = 30

01Narrative

Acleris variana, the eastern blackheaded budworm, is a moth of the family Tortricidae. It is found in Newfoundland and Cape Breton Island and the north-eastern United States, across the coniferous forest region of Canada, presumably to Saskatchewan or eastern Alberta. The larvae mainly feed on Abies balsamea (Balsam Fir) and Picea glauca (White Spruce).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding263 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris variana has left across the world's sequence archives.

At a glance

DNA specimens263

BINs1

Marker genes1

eDNA detections307

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P645 bp consensus256 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

37Gmostly conserved

91Tmostly conserved

99Tmostly conserved

102Tvariable

265Cmostly conserved

270Cvariable

354Tmostly conserved

534Gmostly conserved

537Cmostly conserved

ACGTTATATTTCATTTTTGGTATTTGAGCAGGTATAGTTGGAACTTCTTTAAGATTATTAATTCGAGCAGAACTAGGAAACCCCGGATCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.63%

Haplotypes28

BIN1

Most divergent pair1.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris chalybeanasame genus5.6%Acleris maculidorsanasame genus5.6%Acleris braunanasame genus5.7%Acleris kochiellasame genus5.7%Acleris forsskaleanasame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Acleris variana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 301×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

08Occurrence & distribution

Record type1 235 records

Wild obs. + sensor701

Museum / vouchered534

Range

Area of Occupancy AOO1 444 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 530≤1 km 55≤10 km 8>10 km 31

624 georeferenced · 77 without coordinates

Open the mapobservation + sensor701

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤1 km 44≤10 km 19>10 km 1

64 georeferenced · 470 without coordinates

Open the institutions mapphysical evidence534

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	101
University of Alberta Museums (UAM)location not on record	95
Cornell University Insect Collectionlocation not on record	65
St. Paul, US	32
Mississippi State, US	26
East Lansing, US	23
Royal Saskatchewan Museumlocation not on record	11
New Haven, US	9

8 institutions · 362 of 534 vouchered records shown · 172 without an institution code

09Environmental DNA307 detections

Where the DNA of Acleris variana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found307

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 307 detections have coordinates

Open the map2 countries0

Forest5. Wetlands (inland)1. Forest & Woodland|1.2 Subarctic Forest1. Forest & Woodland|1.1 Boreal ForestGrasslandMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 8.10–19.4

Seasonal swing summer↔winter25.4 °C

Max temp (day)19.2 °C 13.9–24.6

Min temp (night)9.60 °C 4.20–15.5

Precipitation94.9 mm/mo 51.1–145

Air humidity58.5 % 54.8–63.3

Moisture balance-17.7 mm/mo -59.1–49.6

Vapour deficit677 Pa 471–910

Wind speed3.00 m/s 1.90–4.40

Cloud cover40.0 % 33.7–52.8

CHELSA 1981–2010, ~9 km grid, at location & month of 305 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acleris variana

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 235 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 235 records