Acleris forsskaleana

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records25 292

Data sources9

Biological traits2

DNA specimens105

eDNA detections101

Sources9 archives

Databases and archives Acleris forsskaleana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility25 292 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI101 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics105 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF25 292 records

Environmental DNA2 datasets · 16 countries101 detections

DNA & barcodingBOLD105 specimens

Genome at a glanceGoaT2n = 30

01Narrative

Acleris forsskaleana, the maple leaftier moth, is a moth of the family Tortricidae. It is found in Europe and North America in woodlands and gardens. The wingspan is 12–17 mm. The ground colour of the forewings is yellowish underlying a reticulated darker pattern and a greyish suffusion across the disc. Julius von Kennel provides a full description. Julius von Kennel, 1921, The Palaearktischen Tortriciden, eine monographische Darstellung. Stuttgart: E. Schweizerbart'sche Verlagsbuchhandlung. 742 pp. - Palaearctic Tortricidae, a monograph.pdf at Zobodat 170 The moth flies from June to September from dusk onwards. The main food plants in Europe are field maple (Acer campestre) and sycamore (A. pseudoplatanus); the larvae can also be found on Norway maple (A. platanoides). The name honours Peter Forsskål.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding105 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris forsskaleana has left across the world's sequence archives.

At a glance

DNA specimens105

BINs1

Marker genes1

eDNA detections101

Countries16

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus91 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

85Tmostly conserved

274Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.47%

Haplotypes10

BIN1

Most divergent pair1.2%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris folianasame genus4.4%Acleris chalybeanasame genus4.6%Acleris ptychogrammossame genus5.0%Acleris lorquinianasame genus5.2%Acleris cervinanasame genus5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Acleris forsskaleana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 301×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

08Occurrence & distribution

Record type25 292 records

Wild obs. + sensor23 830

Museum / vouchered1 421

Cultivated / captive1

Other40

Origin

Native146

Introduced1

Range

Area of Occupancy AOO22 124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy45% within 1 km

≤100 m 7 648≤1 km 2 119≤10 km 11 810>10 km 136

21 713 georeferenced · 2 117 without coordinates

Open the mapobservation + sensor23 830

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 746≤1 km 152≤10 km 125>10 km 4

1 027 georeferenced · 394 without coordinates

Open the institutions mapphysical evidence1 421

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	677
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	158
NHMOlocation not on record	78
Tartu, EE	47
SLU Artdatabankenlocation not on record	40
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	38
Nijmegen, NL	34
Salzburg, AT	29
Philadelphia, US	25
Natural History Museum Rotterdamlocation not on record	20
Stockholm, SE	19
University of Guelph, Centre for Biodiversity Genomicslocation not on record	18
Kuopio, FI	18
Provincia di Livornolocation not on record	13
Tallinn, EE	10
East Lansing, US	9
ZMAAlocation not on record	8
Cornell University Insect Collectionlocation not on record	8
New Haven, US	7
DABUHlocation not on record	7
NTNU-VMlocation not on record	6
Rovaniemi, FI	6
South Kensington, GB	4
European Distributed Institute of Taxonomy (EDIT)location not on record	4
University of Kaiserslauternlocation not on record	3
Radicondoli, IT	3
Edmonton, CA	2
Brussels, BE	2
NMBU:MINAlocation not on record	2
St. Paul, US	1
NTNU University Museum, Department of Natural Historylocation not on record	1
SZOPKlocation not on record	1
Tiroler Landesmuseum Ferdinandeumlocation not on record	1
MZLUlocation not on record	1
Research Collection of Kai Berggrenlocation not on record	1
University of Alaska Museumlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

37 institutions · 1 303 of 1 421 vouchered records shown · 118 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA101 detections

Where the DNA of Acleris forsskaleana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found101

Studies independent surveys2

Countries16

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 101 detections have coordinates

Open the map16 countries0

farmTemperate mixed forest1.1. Boreal Forest|1. Forest & WoodlandUrbanedge woodland/meadowlowland deciduous forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 10.7–20.8

Seasonal swing summer↔winter20.5 °C

Max temp (day)22.8 °C 14.8–25.7

Min temp (night)13.6 °C 5.70–16.4

Precipitation86.6 mm/mo 53.4–118

Air humidity58.7 % 56.7–63.9

Moisture balance-51.7 mm/mo -85.2–47.8

Vapour deficit858 Pa 473–1,051

Wind speed3.00 m/s 1.70–4.10

Cloud cover39.0 % 33.3–48.3

CHELSA 1981–2010, ~9 km grid, at location & month of 97 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acleris forsskaleana

At a glance

Sources9 archives

Diet & foraging2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type25 292 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 37 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type25 292 records