Acleris cervinana

(Fernald, 1882) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records403

Data sources8

Biological traits0

DNA specimens55

eDNA detections78

Sources8 archives

Databases and archives Acleris cervinana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility403 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI78 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics55 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF403 records

Environmental DNA1 datasets · 2 countries78 detections

DNA & barcodingBOLD55 specimens

01Narrative

Acleris cervinana is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded across Canada from British Columbia to New Brunswick and south to California and Alabama in the United States.mothphotographersgroup The wingspan is 15–17 mm. The forewings are usually deep orange-brown, with a dark brown costal triangle enclosing a white rectangular spot on the costa. In form americana, the ground colour is paler and more fawn-coloured. Furthermore, the white spot in the costal triangle is replaced by one of the ground colour.McDunnough, J. 1934. The Canadian species of the Tortricid genus Peronea. Canadian Journal of Research, 1934, 11(3): 290–332 Adults have been recorded on wing nearly year round. The larvae feed on Betula alleghaniensis, Corylus and Alnus species.Tortricidae Food Plant Database

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding55 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris cervinana has left across the world's sequence archives.

At a glance

DNA specimens55

BINs1

Marker genes1

eDNA detections78

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus55 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

1Amostly conserved

73Gmostly conserved

451Cmostly conserved

517Gmostly conserved

535Avariable

538Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAGTTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.93%

Haplotypes8

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris subnivanasame genus2.3%Acleris kearfottanasame genus2.6%Acleris cornanasame genus3.0%Acleris ferrumixtanasame genus3.5%Acleris forbesanasame genus3.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type403 records

Wild obs. + sensor250

Museum / vouchered153

Range

Area of Occupancy AOO856 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 142≤1 km 26≤10 km 7>10 km 21

196 georeferenced · 54 without coordinates

Open the mapobservation + sensor250

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤1 km 2≤10 km 9

11 georeferenced · 142 without coordinates

Open the institutions mapphysical evidence153

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	48
University of Alberta Museums (UAM)location not on record	36
North Carolina State University Insect Museumlocation not on record	21
University of Guelph, Centre for Biodiversity Genomicslocation not on record	18
New Haven, US	4
King Saud Universitylocation not on record	4
Cornell University Insect Collectionlocation not on record	4
Vernal, US	1
Mississippi State, US	1
Natural History Museum of Utahlocation not on record	1
Essig Museum of Entomologylocation not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1

12 institutions · 140 of 153 vouchered records shown · 13 without an institution code

09Environmental DNA78 detections

Where the DNA of Acleris cervinana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found78

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 78 detections have coordinates

Open the map2 countries0

1. Forest & Woodland1. Forest & Woodland|1.1. Boreal ForestForest1. Forest & Woodland|1.4. Temperate ForestGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.4 °C 5.30–17.1

Seasonal swing summer↔winter29.4 °C

Max temp (day)16.5 °C 9.90–21.9

Min temp (night)7.20 °C 1.70–13.5

Precipitation98.2 mm/mo 63.6–118

Air humidity58.9 % 53.9–62.6

Moisture balance1.40 mm/mo

Vapour deficit560 Pa 370–757

Wind speed3.40 m/s

Cloud cover47.7 % 38.5–58.0

CHELSA 1981–2010, ~9 km grid, at location & month of 77 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)