Acleris subnivana

(Walker, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records431

Data sources8

Biological traits0

DNA specimens28

eDNA detections27

Sources8 archives

Databases and archives Acleris subnivana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility431 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF431 records

Environmental DNA1 datasets · 2 countries27 detections

DNA & barcodingBOLD28 specimens

01Narrative

Acleris subnivana, the common acleris, is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Arkansas, Illinois, Indiana, Kentucky, Maine, Maryland, Massachusetts, Michigan, Mississippi, New Brunswick, New Hampshire, New York, North Carolina, Ohio, Oklahoma, Ontario, Pennsylvania, Quebec, South Carolina, Tennessee, West Virginia and Wisconsin.mothphotographersgroup The wingspan is 15–16 mm. The forewings are usually white with a grayish brown triangle in the middle of the costa. There is however some variation in the ground color, with some specimens being tan colored. Furthermore, some specimens have a slight pale brownish band.Bug Guide Adults have been recorded on wing year round. The larvae feed on Vernonia and Quercus species (including Quercus rubra).Tortricidae Food Plant Database

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris subnivana has left across the world's sequence archives.

At a glance

DNA specimens28

BINs1

Marker genes1

eDNA detections27

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

268Gmostly conserved

508Gmostly conserved

562Gmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.21%

Haplotypes11

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris cervinanasame genus2.3%Acleris cornanasame genus2.3%Acleris braunanasame genus2.4%Acleris forbesanasame genus2.7%Acleris kearfottanasame genus2.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type431 records

Wild obs. + sensor336

Museum / vouchered95

Range

Area of Occupancy AOO1 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 207≤1 km 38≤10 km 20>10 km 22

287 georeferenced · 49 without coordinates

Open the mapobservation + sensor336

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 1≤1 km 6≤10 km 2>10 km 2

11 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence95

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	45
Cornell University Insect Collectionlocation not on record	11
North Carolina State University Insect Museumlocation not on record	11
East Lansing, US	7
Mississippi State, US	5
New Haven, US	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
CUlocation not on record	1
Research Collection of Daniel Handfieldlocation not on record	1

9 institutions · 85 of 95 vouchered records shown · 10 without an institution code

09Environmental DNA27 detections

Where the DNA of Acleris subnivana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.1 °C 6.60–14.3

Seasonal swing summer↔winter31.1 °C

Max temp (day)16.5 °C 12.0–19.7

Min temp (night)5.40 °C 1.20–9.10

Precipitation89.3 mm/mo 71.7–106

Air humidity55.3 % 54.9–56.9

Moisture balance-14.1 mm/mo -46.4–4.90

Vapour deficit569 Pa 438–701

Wind speed3.80 m/s 3.10–4.60

Cloud cover48.0 % 40.8–51.3

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)