Acleris cornana

(McDunnough, 1933) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records228

Data sources8

Biological traits0

DNA specimens103

eDNA detections100

Sources8 archives

Databases and archives Acleris cornana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility228 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI100 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics103 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF228 records

Environmental DNA1 datasets · 1 countries100 detections

DNA & barcodingBOLD103 specimens

01Narrative

Acleris cornana is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Alberta, British Columbia, Illinois, Indiana, Kentucky, Maine, Manitoba, Maryland, Michigan, Minnesota, New Brunswick, New York, North Carolina, Ohio, Ontario, Quebec, Vermont, Washington and Wisconsin.mothphotographersgroup The wingspan is 14–16 mm. The forewings are uniform olive grey.McDunnough, J. 1934. The Canadian species of the Tortricid genus Peronea. Canadian Journal of Research, 1934, 11(3): 290-332 Adults have been recorded on wing from March to November. The larvae feed on Alnus incana and Cornus species (including Cornus canadensis, Cornus racemosa and Cornus sericea).Tortricidae Food Plant Database

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding103 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris cornana has left across the world's sequence archives.

At a glance

DNA specimens103

BINs1

Marker genes1

eDNA detections100

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus92 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

409Gmostly conserved

562Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGGAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.59%

Haplotypes10

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris subnivanasame genus2.3%Acleris cervinanasame genus3.0%Acleris braunanasame genus3.2%Acleris ferrumixtanasame genus3.3%Acleris implexanasame genus3.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type228 records

Wild obs. + sensor52

Museum / vouchered176

Range

Area of Occupancy AOO420 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 26≤1 km 7≤10 km 5>10 km 4

42 georeferenced · 10 without coordinates

Open the mapobservation + sensor52

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤1 km 33>10 km 4

37 georeferenced · 139 without coordinates

Open the institutions mapphysical evidence176

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	45
East Lansing, US	36
St. Paul, US	12
University of Alberta Museums (UAM)location not on record	11
Research Collection of Daniel Handfieldlocation not on record	4
Biodiversity Institute of Ontariolocation not on record	1
Mississippi State, US	1
Cornell University Insect Collectionlocation not on record	1
Washington State Department of Agriculturelocation not on record	1

9 institutions · 112 of 176 vouchered records shown · 64 without an institution code

09Environmental DNA100 detections

Where the DNA of Acleris cornana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found100

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 100 detections have coordinates

Open the map1 country0

1. Forest & Woodland1. Forest & Woodland|1.1. Boreal ForestfarmTemperate mixed forestForestUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.20 °C 6.60–20.4

Seasonal swing summer↔winter26.9 °C

Max temp (day)12.4 °C 9.10–25.2

Min temp (night)5.20 °C 1.40–16.1

Precipitation83.0 mm/mo 69.0–110

Air humidity58.0 % 54.8–60.8

Moisture balance-11.0 mm/mo -61.2–22.6

Vapour deficit448 Pa 405–1,016

Wind speed4.00 m/s 2.60–7.00

Cloud cover47.7 % 39.4–55.0

CHELSA 1981–2010, ~9 km grid, at location & month of 99 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)