Acleris implexana

(Walker, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records86

Data sources8

Biological traits0

DNA specimens41

eDNA detections55

Sources8 archives

Databases and archives Acleris implexana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility86 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI55 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics41 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF86 records

Environmental DNA1 datasets · 2 countries55 detections

DNA & barcodingBOLD41 specimens

01Narrative

Acleris implexana is a species of moth of the family Tortricidae. It is found in Norway, Sweden, Finland, RussiaFauna Europaea and North America, where it has been recorded from Quebec to British Columbia and adjacent areas of the United States.mothphotographersgroup The wingspan is 13–14 mm. The forewings are light yellowish with a grey triangular or semicircular patch along the costa, containing several darker grey spots. The hindwings are uniform and slightly paler than the forewings. Adults are on wing from late August to October. The larvae feed on the leaves of Pinus and Salix species. They have also been recorded feeding in the pine cone willow gall, caused by the gall midge Rabdophaga strobiloides.Bug Guide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding41 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris implexana has left across the world's sequence archives.

At a glance

DNA specimens41

BINs2

Marker genes1

eDNA detections55

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 31 variable positions, in barcode order

34Tmostly conserved

50Tmostly conserved

64Cmostly conserved

67Gmostly conserved

85Cvariable

112Tmostly conserved

115Tmostly conserved

160Gmostly conserved

178Tmostly conserved

187Tmostly conserved

193Cmostly conserved

202Amostly conserved

211Amostly conserved

232Tmostly conserved

238Tmostly conserved

262Gmostly conserved

271Amostly conserved

304Tmostly conserved

316Tmostly conserved

400Tmostly conserved

490Cmostly conserved

514Tmostly conserved

542Tmostly conserved

562Amostly conserved

577Gmostly conserved

581Cmostly conserved

601Tvariable

619Cmostly conserved

625Amostly conserved

646Cmostly conserved

655Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATCCGGGCAGAATTAGGAAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes9

BINs2

Most divergent pair4.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris cornanasame genus3.5%Acleris ferrumixtanasame genus3.8%Acleris forbesanasame genus3.8%Acleris subnivanasame genus3.8%Acleris cervinanasame genus4.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type86 records

Wild obs. + sensor25

Museum / vouchered61

Range

Area of Occupancy AOO160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 12≤1 km 10≤10 km 2

24 georeferenced · 1 without coordinates

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 9

10 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence61

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
University of Alberta Museums (UAM)location not on record	6
East Lansing, US	5
MZLUlocation not on record	4
Research Collection of Daniel Handfieldlocation not on record	4
NHMOlocation not on record	4
St. Paul, US	2
Research Collection of Kai Berggrenlocation not on record	1
SLU Artdatabankenlocation not on record	1

9 institutions · 35 of 61 vouchered records shown · 26 without an institution code

09Environmental DNA55 detections

Where the DNA of Acleris implexana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found55

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 55 detections have coordinates

Open the map2 countries0

Forest1. Forest & Woodland|1.1. Boreal ForestforestTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.70 °C 6.20–19.3

Seasonal swing summer↔winter29.2 °C

Max temp (day)15.4 °C 11.3–24.7

Min temp (night)6.20 °C 1.00–14.7

Precipitation86.2 mm/mo 51.9–113

Air humidity56.5 % 54.8–60.5

Moisture balance-11.0 mm/mo -58.8–54.8

Vapour deficit541 Pa 414–944

Wind speed3.60 m/s 2.50–4.10

Cloud cover47.9 % 39.8–55.1

CHELSA 1981–2010, ~9 km grid, at location & month of 42 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)