Acleris forbesana

(McDunnough, 1934) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records524

Data sources8

Biological traits0

DNA specimens55

eDNA detections55

Sources8 archives

Databases and archives Acleris forbesana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility524 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI55 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics55 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF524 records

Environmental DNA1 datasets · 2 countries55 detections

DNA & barcodingBOLD55 specimens

01Narrative

Acleris forbesana, the Forbes' acleris moth, is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Alberta, British Columbia, California, Illinois, Indiana, Maine, Massachusetts, Michigan, Minnesota, New Brunswick, North Carolina, Ontario, Quebec, Tennessee and Wisconsin.mothphotographersgroup The wingspan is 13–16 mm. The forewings are whitish with a dark grey triangular patch along the costa and lighter grey patches near the anal angle, in the subterminal area and in the basal area. The hindwings are uniform pale grey or silvery. Adults have been recorded on wing from March to April and again from June to October in two or more generations per year.Bug Guide The larvae feed on Cornus species (including Cornus californica and Cornus sericea).Tortricidae Food Plant Database

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding55 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris forbesana has left across the world's sequence archives.

At a glance

DNA specimens55

BINs1

Marker genes1

eDNA detections55

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus52 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

85Cmostly conserved

265Gmostly conserved

607Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.58%

Haplotypes12

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris subnivanasame genus2.7%Acleris cervinanasame genus3.5%Acleris cornanasame genus3.5%Acleris kearfottanasame genus3.5%Acleris braunanasame genus3.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type524 records

Wild obs. + sensor404

Museum / vouchered120

Range

Area of Occupancy AOO800 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 312≤1 km 29≤10 km 1>10 km 15

357 georeferenced · 47 without coordinates

Open the mapobservation + sensor404

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤1 km 12≤10 km 8>10 km 1

21 georeferenced · 99 without coordinates

Open the institutions mapphysical evidence120

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	34
University of Guelph, Centre for Biodiversity Genomicslocation not on record	21
East Lansing, US	19
St. Paul, US	3
Cambridge, US	1
Centre for Biodiversity Genomicslocation not on record	1

6 institutions · 79 of 120 vouchered records shown · 41 without an institution code

09Environmental DNA55 detections

Where the DNA of Acleris forbesana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found55

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 55 detections have coordinates

Open the map2 countries0

Temperate mixed forestForest1. Forest & Woodland1. Forest & Woodland|1.1. Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.70 °C 5.10–14.2

Seasonal swing summer↔winter26.1 °C

Max temp (day)13.6 °C 9.80–19.6

Min temp (night)4.50 °C 0.1–10.2

Precipitation81.7 mm/mo 58.8–105

Air humidity58.3 % 54.0–61.6

Moisture balance-15.4 mm/mo -48.6–27.4

Vapour deficit448 Pa 372–683

Wind speed3.50 m/s 2.40–4.90

Cloud cover47.9 % 41.5–55.0

CHELSA 1981–2010, ~9 km grid, at location & month of 51 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)