Acleris braunana

(McDunnough, 1934) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records243

Data sources8

Biological traits0

DNA specimens23

eDNA detections1

Sources8 archives

Databases and archives Acleris braunana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility243 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF243 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD23 specimens

01Narrative

Acleris braunana is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Alberta, British Columbia, Indiana, Maine, Michigan, New Brunswick, New York, Nova Scotia, Oregon, Pennsylvania, Quebec, Saskatchewan, West Virginia and Wisconsin.mothphotographersgroupBug Guide The wingspan is about 15 mm. The forewings are deep red-brown or purple-brown with a shading of grey scaling along the inner margin. There is a strong purple-black costal triangle, as well as a faint line of white scaling. The hindwings are pale smoky.McDunnough, J. 1934. The Canadian species of the Tortricid genus Peronea. Canadian Journal of Research, 1934, 11(3): 290-332 Adults have been recorded on wing from March to December. The larvae feed on Alnus (including Alnus incana, Alnus rubra) and Betula species (including Betula papyrifera).Tortricidae Food Plant Database

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris braunana has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

22Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAGTTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.11%

Haplotypes7

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris subnivanasame genus2.4%Acleris kearfottanasame genus2.7%Acleris cornanasame genus3.2%Acleris ferrumixtanasame genus3.6%Acleris forbesanasame genus3.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type243 records

Wild obs. + sensor221

Museum / vouchered22

Range

Area of Occupancy AOO396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 163≤1 km 9≤10 km 2>10 km 13

187 georeferenced · 34 without coordinates

Open the mapobservation + sensor221

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 3

6 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	11
New Haven, US	5
University of Alberta Museums (UAM)location not on record	4
Cambridge, US	1
Research Collection of Daniel Handfieldlocation not on record	1

5 institutions · 22 of 22 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Acleris braunana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.8 °C 10.8–10.8

Seasonal swing summer↔winter28.3 °C

Max temp (day)14.6 °C

Min temp (night)7.10 °C

Precipitation162 mm/mo

Air humidity58.0 %

Moisture balance41.8 mm/mo

Vapour deficit543 Pa

Wind speed3.20 m/s

Cloud cover52.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)