Acleris lorquiniana

(Duponchel, 1835) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records483

Data sources10

Biological traits2

DNA specimens10

eDNA detections10

Sources10 archives

Databases and archives Acleris lorquiniana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility483 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF483 records

Environmental DNA1 datasets · 4 countries10 detections

DNA & barcodingBOLD10 specimens

Genome at a glanceGoaT · NCBI≈591 Mbp

01Narrative

Acleris lorquiniana, the marsh button, is a species of moth of the family Tortricidae. It is found in Iran, 2009: A brief study on the tribes Tortricini and Archipini (Lepidoptera: Tortricinae) from Iran. Entomofauna Band 30, Heft 10: 137–152. and central and northern Europe, where it has been recorded from Great Britain, France, Belgium, the Netherlands, Germany, Denmark, Austria, Switzerland, the Czech Republic, Slovakia, Poland, Romania, Hungary, Sweden, Finland, the Baltic region and Russia.Fauna Europaea The habitat consists of damp fenland. The wingspan is 15–20 mm. The forewings are brownish ochreous.Hants Moths Adults are on wing from June to July and again from September to October in two generations per year. The larvae feed on Lythrum salicaria. They feed on the shoots, flowers and seeds of their host plant.UKmoths Pupation takes place in debris on the ground. The species overwinters as an adult.Lepidoptera of Belgium

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris lorquiniana has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections10

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.04%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

256Tmostly conserved

AACTTTATATTTCATTTTTGGTATTTGAGCAGGTATAGTAGGAACCTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris kochiellasame genus5.0%Acleris forsskaleanasame genus5.2%Acleris cervinanasame genus5.2%Acleris sparsanasame genus5.2%Acleris subnivanasame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acleris lorquiniana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈591 274 584 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acleris lorquiniana0.59 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.5% BUSCO

08Occurrence & distribution

Record type483 records

Wild obs. + sensor356

Museum / vouchered121

Other6

Range

Area of Occupancy AOO856 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy44% within 1 km

≤100 m 84≤1 km 66≤10 km 190>10 km 3

343 georeferenced · 13 without coordinates

Open the mapobservation + sensor356

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 21≤1 km 23≤10 km 37

81 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence121

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	52
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	30
Tartu, EE	11
SLU Artdatabankenlocation not on record	11
South Kensington, GB	2
Stockholm, SE	1
Research Collection of Hartmut Wegnerlocation not on record	1
Uniwersytet Łódzkilocation not on record	1

8 institutions · 109 of 121 vouchered records shown · 12 without an institution code

09Environmental DNA10 detections

Where the DNA of Acleris lorquiniana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.1 °C 5.70–17.7

Seasonal swing summer↔winter20.1 °C

Max temp (day)12.9 °C 7.20–21.3

Min temp (night)9.10 °C 3.90–14.0

Precipitation57.0 mm/mo 41.3–68.8

Air humidity64.7 % 61.1–65.6

Moisture balance-41.7 mm/mo -87.6–4.80

Vapour deficit492 Pa 375–766

Wind speed5.40 m/s 4.00–6.50

Cloud cover44.8 % 37.4–49.6

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)