Acleris kochiella

(Goeze, 1783) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records463

Data sources8

Biological traits2

DNA specimens12

eDNA detections14

Sources8 archives

Databases and archives Acleris kochiella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility463 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF463 records

Environmental DNA1 datasets · 5 countries14 detections

DNA & barcodingBOLD12 specimens

01Narrative

Acleris kochiella is a moth of the family Tortricidae. It is found in most of Europe, Kazakhstan, the Ural region, Irkutsk and China. The wingspan is 15–18 mm. Adults are on the wing from June to July and in September. There are two generations per year. The larvae feed on Ulmus species. They feed on folded or spun leaves.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris kochiella has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections14

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

505Tmostly conserved

508Gmostly conserved

AACATTATATTTCATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.08%

Haplotypes3

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris boscanoidessame genus2.3%Acleris logianasame genus3.3%Acleris maximanasame genus3.3%Acleris placidanasame genus3.5%Acleris roscidanasame genus4.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type463 records

Wild obs. + sensor424

Museum / vouchered31

Other8

Range

Area of Occupancy AOO736 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 231≤1 km 20≤10 km 146

397 georeferenced · 27 without coordinates

Open the mapobservation + sensor424

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 6≤1 km 5≤10 km 11

22 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence31

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum Rotterdamlocation not on record	11
Tartu, EE	3
Provincia di Livornolocation not on record	3
DanishLepidopterologicalSocietylocation not on record	2
Salzburg, AT	1
Nijmegen, NL	1
University of Kaiserslauternlocation not on record	1
South Kensington, GB	1
SLU Artdatabankenlocation not on record	1

9 institutions · 24 of 31 vouchered records shown · 7 without an institution code

09Environmental DNA14 detections

Where the DNA of Acleris kochiella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map5 countries0

1.1. Boreal Forest|1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 5.70–20.4

Seasonal swing summer↔winter19.6 °C

Max temp (day)18.9 °C 9.80–24.2

Min temp (night)8.60 °C 0.9–14.7

Precipitation78.4 mm/mo 46.2–149

Air humidity59.9 % 56.9–61.8

Moisture balance-10.8 mm/mo -75.4–42.0

Vapour deficit635 Pa 372–987

Wind speed2.50 m/s 1.30–4.10

Cloud cover40.6 % 38.1–49.3

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)