Acleris roscidana

(Hübner, 1796-1799) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records705

Data sources6

Biological traits0

DNA specimens10

eDNA detections10

Sources6 archives

Databases and archives Acleris roscidana's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility705 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF705 records

Environmental DNA1 datasets · 5 countries10 detections

DNA & barcodingBOLD10 specimens

01Narrative

Acleris roscidana is a species of moth of the family Tortricidae. It is found in France, Germany, Austria, Switzerland, Italy, the Czech Republic, Slovakia, Hungary, Poland, Romania, Norway, Sweden, Finland, the Baltic region, Ukraine and Russia.Fauna Europaea The wingspan is 26–28 mm. Adults are on wing from September to March. The larvae feed on Populus tremula. Larvae can be found from June to July.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris roscidana has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections10

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

217Amostly conserved

238Gmostly conserved

280Tmostly conserved

616Tmostly conserved

649Amostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGGGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes5

BIN1

Most divergent pair0.46%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris maximanasame genus3.0%Acleris nigrolineasame genus3.8%Acleris kochiellasame genus4.0%Acleris varieganasame genus4.4%Acleris maculidorsanasame genus4.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type705 records

Wild obs. + sensor527

Museum / vouchered173

Other5

Range

Area of Occupancy AOO1 328 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 246≤1 km 200≤10 km 71

517 georeferenced · 10 without coordinates

Open the mapobservation + sensor527

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 68≤1 km 73≤10 km 7

148 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence173

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	43
Tartu, EE	24
Provincia di Livornolocation not on record	20
SLU Artdatabankenlocation not on record	14
DanishLepidopterologicalSocietylocation not on record	13
KIRMlocation not on record	10
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	6
NMBU:MINAlocation not on record	2
NTNU-VMlocation not on record	2
University of Kaiserslauternlocation not on record	2
neflocation not on record	2
Helsinki, FI	1
Tallinn, EE	1
Uniwersytet Łódzkilocation not on record	1

14 institutions · 141 of 173 vouchered records shown · 32 without an institution code

09Environmental DNA10 detections

Where the DNA of Acleris roscidana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.10 °C 2.50–9.70

Seasonal swing summer↔winter19.5 °C

Max temp (day)7.50 °C 5.90–12.1

Min temp (night)2.80 °C -3.10–7.50

Precipitation59.5 mm/mo 44.5–143

Air humidity62.2 % 58.4–64.6

Moisture balance-14.5 mm/mo -53.3–63.5

Vapour deficit381 Pa 295–454

Wind speed3.50 m/s 2.40–6.10

Cloud cover43.2 % 40.1–48.5

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)