Acleris maximana

(Barnes & Busck, 1920) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records228

Data sources8

Biological traits0

DNA specimens36

eDNA detections30

Sources8 archives

Databases and archives Acleris maximana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility228 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF228 records

Environmental DNA1 datasets · 2 countries30 detections

DNA & barcodingBOLD36 specimens

01Narrative

Acleris maximana is a species of moth of the family Tortricidae first described by William Barnes and August Busck in 1920. It is found in North America, where it has been recorded from Alberta, British Columbia, California, Maryland, Massachusetts, Montana, New Brunswick, North Carolina, Ontario, Pennsylvania, Saskatchewan, Tennessee, Utah and Washington. The wingspan is 21–28 mm. The forewings are blue grey, variably mottled and suffused with smoky shades, as well as with very fine, broken dark lines on the vein.McDunnough, J. (1934). "The Canadian species of the Tortricid genus Peronea". Canadian Journal of Research. 1934, 11(3): 290–332 Adults have been recorded on wing nearly year round. The larvae feed on Prunus emarginata, Salix, Malus (including Malus pumila) and Populus species (including Populus balsamifera, Populus tremula and Populus tremuloides).Tortricidae Food Plant Database

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris maximana has left across the world's sequence archives.

At a glance

DNA specimens36

BINs3

Marker genes1

eDNA detections30

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

13Tvariable

22Tvariable

40Amostly conserved

56Cvariable

115Cvariable

118Tvariable

169Tvariable

181Amostly conserved

193Tvariable

220Cvariable

235Tvariable

274Tmostly conserved

364Tmostly conserved

385Cmostly conserved

415Amostly conserved

421Avariable

485Tvariable

517Avariable

577Avariable

646Cvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACCTCATTAAGACTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes12

BINs3

Most divergent pair2.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris nigrolineasame genus3.0%Acleris roscidanasame genus3.0%Acleris kochiellasame genus3.3%Acleris lacordairanasame genus3.8%Acleris ptychogrammossame genus4.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type228 records

Wild obs. + sensor129

Museum / vouchered99

Range

Area of Occupancy AOO304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 72≤1 km 22≤10 km 3>10 km 7

104 georeferenced · 25 without coordinates

Open the mapobservation + sensor129

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 3≤1 km 3≤10 km 8

14 georeferenced · 85 without coordinates

Open the institutions mapphysical evidence99

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	70
New Haven, US	8
Edmonton, CA	4
St. Paul, US	3
Cornell University Insect Collectionlocation not on record	2
Research Collection of Daniel Handfieldlocation not on record	2
ASUlocation not on record	1
San Francisco, US	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1

9 institutions · 92 of 99 vouchered records shown · 7 without an institution code

09Environmental DNA30 detections

Where the DNA of Acleris maximana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map2 countries0

rural1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.20 °C 2.60–12.2

Seasonal swing summer↔winter13.1 °C

Max temp (day)11.8 °C 6.80–15.9

Min temp (night)4.20 °C -2.70–9.10

Precipitation102 mm/mo 61.8–242

Air humidity60.8 % 53.1–65.6

Moisture balance35.5 mm/mo -27.5–183

Vapour deficit408 Pa 298–555

Wind speed2.80 m/s 1.90–5.90

Cloud cover47.2 % 41.7–53.6

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)