Acleris lacordairana

(Duponchel, 1836) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records98

Data sources7

Biological traits0

DNA specimens7

eDNA detections0

Sources7 archives

Databases and archives Acleris lacordairana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility98 records↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF98 records

DNA & barcodingBOLD7 specimens

01Narrative

Acleris lacordairana is a species of moth of the family Tortricidae. It is found in Germany, Austria, Switzerland, Italy, Hungary, Poland, Estonia, Latvia and Russia.Fauna Europaea In the east, the range extends to Japan.Japanese Moths The wingspan is 16–18 mm. Adults are on wing from June to September. The larvae feed on UlmusCheck List of the Tribe Tortricini (Lepidoptera: Tortricidae) in Northeast china, with Two Newly Recorded Species from China and Salix species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris lacordairana has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.22%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 3 variable positions, in barcode order

38Avariable

364Tvariable

553Cvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAATTGGAACCTCTTTAAGATTATTAATTCGAGCAGAATTAGGGAACCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris maximanasame genus3.8%Acleris ptychogrammossame genus4.4%Acleris cristanasame genus4.6%Acleris kochiellasame genus4.6%Acleris sparsanasame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type98 records

Wild obs. + sensor72

Museum / vouchered21

Other5

Range

Area of Occupancy AOO304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 32≤1 km 10≤10 km 4>10 km 4

50 georeferenced · 22 without coordinates

Open the mapobservation + sensor72

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 8

10 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	7
Tartu, EE	4
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	2
KIRMlocation not on record	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
neflocation not on record	1

6 institutions · 16 of 21 vouchered records shown · 5 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)