Acleris sparsana

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records7 643

Data sources9

Biological traits2

DNA specimens45

eDNA detections46

Sources9 archives

Databases and archives Acleris sparsana's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 643 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI46 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics45 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF7 643 records

Environmental DNA2 datasets · 10 countries46 detections

DNA & barcodingBOLD45 specimens

Genome at a glanceGoaT · NCBI≈590 Mbp

01Narrative

Acleris sparsana is a moth of the family Tortricidae found in Europe and Iran. It was first described in 1775 by the Austrian lepidopterists Michael Denis and Ignaz Schiffermüller.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding45 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris sparsana has left across the world's sequence archives.

At a glance

DNA specimens45

BINs1

Marker genes1

eDNA detections46

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus40 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

86Amostly conserved

AACATTATATTTTATCTTCGGTATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAACTAGGAAATCCTAGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.05%

Haplotypes3

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris cervinanasame genus4.1%Acleris subnivanasame genus4.1%Acleris maximanasame genus4.3%Acleris braunanasame genus4.3%Acleris hyemanasame genus4.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acleris sparsana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈589 529 688 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acleris sparsana0.59 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.3% BUSCO

08Occurrence & distribution

Record type7 643 records

Wild obs. + sensor6 593

Museum / vouchered937

Other113

Origin

Native17

Range

Area of Occupancy AOO9 068 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 2 622≤1 km 826≤10 km 2 609>10 km 16

6 073 georeferenced · 520 without coordinates

Open the mapobservation + sensor6 593

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 505≤1 km 192≤10 km 129>10 km 2

828 georeferenced · 109 without coordinates

Open the institutions mapphysical evidence937

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	521
Provincia di Livornolocation not on record	80
NHMOlocation not on record	71
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	57
Salzburg, AT	45
CBDClocation not on record	25
Tartu, EE	25
Nijmegen, NL	14
SLU Artdatabankenlocation not on record	10
Natural History Museum Rotterdamlocation not on record	9
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	6
European Distributed Institute of Taxonomy (EDIT)location not on record	3
Stockholm, SE	3
Uniwersytet Łódzkilocation not on record	3
South Kensington, GB	3
neflocation not on record	2
Cambridge, US	2
NTNU-VMlocation not on record	2
MZLUlocation not on record	2
ZSMlocation not on record	1
BioFokuslocation not on record	1
University of Kaiserslauternlocation not on record	1
Kuopio, FI	1
Zürich, CH	1
Natural History Museum, Londonlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
NMBU:MINAlocation not on record	1
NTNU University Museum, Department of Natural Historylocation not on record	1

28 institutions · 892 of 937 vouchered records shown · 45 without an institution code

09Environmental DNA46 detections

Where the DNA of Acleris sparsana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found46

Studies independent surveys2

Countries10

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 46 detections have coordinates

Open the map10 countries0

Acer campestrelowland deciduous forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.5 °C 7.10–17.5

Seasonal swing summer↔winter19.0 °C

Max temp (day)15.1 °C 9.40–21.8

Min temp (night)7.80 °C 4.00–13.3

Precipitation82.4 mm/mo 61.4–140

Air humidity62.6 % 58.3–66.5

Moisture balance21.2 mm/mo -29.7–87.5

Vapour deficit500 Pa 376–829

Wind speed3.20 m/s 1.60–4.90

Cloud cover44.8 % 34.7–49.9

CHELSA 1981–2010, ~9 km grid, at location & month of 44 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acleris sparsana

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type7 643 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 643 records