Acleris maculidorsana

(Clemens, 1864) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records534

Data sources8

Biological traits0

DNA specimens15

eDNA detections1

Sources8 archives

Databases and archives Acleris maculidorsana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility534 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF534 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD15 specimens

01Narrative

Acleris maculidorsana, the stained-back leafroller moth, is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Arkansas, Florida, Georgia, Kentucky, Maine, Maryland, Massachusetts, Michigan, Mississippi, New Jersey, North Carolina, Ohio, Ontario, Pennsylvania, South Carolina, Tennessee, Virginia and Wisconsin.mothphotographersgroup The wingspan is 15–18 mm. Adults are similar to Acleris inana and Acleris busckana, but are much grayer species than the former. From busckana it differs in having a dark lunate patch above the inner margin near the base of the wing, which is entirely pale gray.McDunnough, J. 1934. The Canadian species of the Tortricid genus Peronea. Canadian Journal of Research, 1934, 11(3): 290–332 Adults have been recorded on wing nearly year round. The larvae feed on Chamaedaphne calyculata, Hypericum (including Hypericum perforatum), Kalmia and Vaccinium species.Tortricidae Food Plant Database

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris maculidorsana has left across the world's sequence archives.

At a glance

DNA specimens15

BINs2

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 39 variable positions, in barcode order

34Amostly conserved

40Amostly conserved

82Cmostly conserved

97Tmostly conserved

100Tmostly conserved

124Tvariable

163Amostly conserved

181Cvariable

205Tmostly conserved

220Cmostly conserved

223Tmostly conserved

235Tmostly conserved

250Cmostly conserved

253Amostly conserved

268Amostly conserved

284Cmostly conserved

286Tmostly conserved

298Tmostly conserved

307Cmostly conserved

355Amostly conserved

364Tmostly conserved

376Cmostly conserved

394Tmostly conserved

412Cmostly conserved

442Tmostly conserved

484Cmostly conserved

485Tmostly conserved

499Tmostly conserved

508Cvariable

514Tmostly conserved

536Cmostly conserved

541Amostly conserved

565Tmostly conserved

574Amostly conserved

604Amostly conserved

631Amostly conserved

634Tmostly conserved

646Tmostly conserved

658Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes5

BINs2

Most divergent pair5.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris roscidanasame genus4.4%Acleris busckanasame genus4.6%Acleris cristanasame genus4.7%Acleris varieganasame genus4.7%Acleris umbranasame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type534 records

Wild obs. + sensor263

Museum / vouchered271

Range

Area of Occupancy AOO848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 153≤1 km 37≤10 km 13>10 km 16

219 georeferenced · 44 without coordinates

Open the mapobservation + sensor263

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 3≤1 km 29≤10 km 161>10 km 5

198 georeferenced · 73 without coordinates

Open the institutions mapphysical evidence271

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	174
St. Paul, US	55
East Lansing, US	19
Cornell University Insect Collectionlocation not on record	11
Mississippi State, US	6
Cambridge, US	3
CUlocation not on record	2
SOVTlocation not on record	1

8 institutions · 271 of 271 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Acleris maculidorsana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)